View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17060_low_18 (Length: 245)
Name: NF17060_low_18
Description: NF17060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17060_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 12 - 136
Target Start/End: Original strand, 46034994 - 46035118
Alignment:
| Q |
12 |
tgagaaaaatagacccatcaaatttaattttatttcttatgattatcatcattttgcaaatagaaacagaggttaatatgtacaccaccaattctggcat |
111 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46034994 |
tgagaaaaatagacccatcaaattttattttatttcttatgattatcatcattttgcaaatagaaacagaggttaatatgtacaacaccaattctggcat |
46035093 |
T |
|
| Q |
112 |
tggctagctagctacaaatacataa |
136 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
46035094 |
tggctagctagctacaaatacataa |
46035118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 128 - 245
Target Start/End: Original strand, 46036092 - 46036209
Alignment:
| Q |
128 |
aatacataatacaattgagacaacaattttatgctggaattctggaagaaaagaaaaatccctatcataaattaaaccaaataggctcttatcagtgagt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46036092 |
aatacataatacaattgagacaacaattttatgctggaattctgaaagaaaagaaaaatccctatcataaattaaaccaaataggctcttatcaatgagt |
46036191 |
T |
|
| Q |
228 |
atttttaggcataaatga |
245 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
46036192 |
atttttaggcataaatga |
46036209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University