View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17060_low_9 (Length: 356)
Name: NF17060_low_9
Description: NF17060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17060_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 33 - 308
Target Start/End: Complemental strand, 33616394 - 33616120
Alignment:
| Q |
33 |
cccacttgagatatcctaatccgtaaaatacaatnnnnnnnntgacgtcattcattccattgcttatcctagttgaattctatccaaatagtaaaatgag |
132 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33616394 |
cccacttgagatatcctaatccataaaatacaataaaaaaa-tgatgtcattcattccattgtttatcctagttgaattctatccaaatagtaaaatgag |
33616296 |
T |
|
| Q |
133 |
acttatgttcaactacgatagagttattctagttgaaataataaaattatcctagttaaatcaataaatctcataatatcttgtttgatctaaagacaaa |
232 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33616295 |
acttatgttcaactaggatagagttattctagttgaaataataaaattatcctagttaaatcaataaatctcataatatcttgtttgatctaaagacaaa |
33616196 |
T |
|
| Q |
233 |
atatattcatcggataatgaaaattgatttatgcacggtagaattagactccaaacatttgtttataaatttttgg |
308 |
Q |
| |
|
|| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || ||||||| |
|
|
| T |
33616195 |
atttatccatcggataatgaaaattgatttatgcacggtagaattagactccaaacatttgcttaaaattttttgg |
33616120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University