View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17061_high_29 (Length: 354)
Name: NF17061_high_29
Description: NF17061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17061_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 5e-75; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 1353391 - 1353609
Alignment:
| Q |
1 |
caaggtggaatagcagtgatctcgttcttccnnnnnnnnctatactccatatgccnnnnnnnnctttacaatgcaataaaagaatcacatctagaccaaa |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1353391 |
caaggtggaatagcagtgatttcgttcttccaaaaaaaactatactccatatgccaaaaaaaactttacaatgcaataaaagaatcacatctagaccaaa |
1353490 |
T |
 |
| Q |
101 |
attgagatttaaatatgtagaaaccccggtttgaatttagtggaagaaccgttggctacaacgttgaaccggatttggtcaaaccgctcattaccattta |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
1353491 |
attgagatttaaatatgtagaaaccctggtttgaatttagaggaagaaccgttggctacaacgttgaatcgggtttggtcaaaccactcattaccattta |
1353590 |
T |
 |
| Q |
201 |
ttcgatataacttgtttcc |
219 |
Q |
| |
|
|||| |||||||||||||| |
|
|
| T |
1353591 |
ttcggtataacttgtttcc |
1353609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 276 - 325
Target Start/End: Original strand, 1353652 - 1353701
Alignment:
| Q |
276 |
caatcaaataacctaatctttttaaatattcacataatcaaatcatgtaa |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1353652 |
caatcaaataacctaatctttttaaatatttacataatcaaatcatgtaa |
1353701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University