View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17061_high_34 (Length: 306)
Name: NF17061_high_34
Description: NF17061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17061_high_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 13 - 291
Target Start/End: Complemental strand, 47464791 - 47464513
Alignment:
| Q |
13 |
aatatccagttgggagggatggttttattagctttctgaagtctctgcagattgataaagagtgagtttgattatgaatttttgtgggcttcaagtgagt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47464791 |
aatatccagttgggagggatggttttattagctttctgaagtctctgcagattgataaagagtgagtttgattatgaatttttgtgggcttcaagtgagt |
47464692 |
T |
 |
| Q |
113 |
aacacgagtccaaaataaagctgagaggaagtcaaatggggtggcattgagacattttttgttttggattatggagagggaatgtttaatgattgaactt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47464691 |
aacacgagtccaaaataaagctgagaggaagtcaaatggggtggcattgagacattttttgttttggattatggagagggaatgtttaatgattgaactt |
47464592 |
T |
 |
| Q |
213 |
gagaatttgaaagtggctgtggctatgtttgatgaagaggtaatagtttgtggttttagggatgaatttggaatgttgt |
291 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47464591 |
gagaatttgaaagtggctgtggctaggtttgatgaagaggtaatagtttgtggttttagggatgaatttggaatgttgt |
47464513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University