View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17061_high_36 (Length: 297)
Name: NF17061_high_36
Description: NF17061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17061_high_36 |
 |  |
|
| [»] scaffold0039 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 1 - 283
Target Start/End: Original strand, 2989573 - 2989855
Alignment:
| Q |
1 |
accacaatcaaaacacagaataatatcaaacctgacatgttaacaccattgatccctaaatccccaacattcaaacaacaaaagaaaacccatttttctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2989573 |
accacaatcaaaacacagaataatatcaaacctgacatgttaacaccattgatccctaaatccccaacattcaaacaacaaaagaaaacccatttttctc |
2989672 |
T |
 |
| Q |
101 |
ttgccctcaatgaagccaaacatatttcaaacatagcattacctatggttttaacaggtttattactttattctcgttccatcatttcaatgttgttcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2989673 |
ttgccctcaatgaagccaaacatatttcaaacatagcattacctatggttttaacaggtttattactttattctcgttccatcatttcaatgttgttcct |
2989772 |
T |
 |
| Q |
201 |
tggtcgtgttggtgaacttgctttagcaggtgggtcacttgccattggatttgcaaacatcacaggttactccattctctctg |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2989773 |
tggtcgtgttggtgaacttgctttagcaggtgggtcacttgccattggatttgcaaacatcacaggttactccattctctctg |
2989855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 224 - 283
Target Start/End: Original strand, 23660 - 23719
Alignment:
| Q |
224 |
tagcaggtgggtcacttgccattggatttgcaaacatcacaggttactccattctctctg |
283 |
Q |
| |
|
|||| |||||||| ||||| ||||| ||||| |||||||| |||||||||||||| |||| |
|
|
| T |
23660 |
tagctggtgggtcccttgctattggttttgccaacatcactggttactccattctttctg |
23719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University