View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17061_high_49 (Length: 236)
Name: NF17061_high_49
Description: NF17061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17061_high_49 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 17 - 114
Target Start/End: Complemental strand, 2176550 - 2176453
Alignment:
| Q |
17 |
cagagaaatgctaatttgatatcttatcaatttcaatatgaaagtagttttagcaacatnnnnnnntgactgataatttgtattttcaacatctaact |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
2176550 |
cagagaaatgctaatttgatatcttatcaatttcaatatgaaagtagttttagcaacataaaaaaatgactgataatttgtcttttcaacatctaact |
2176453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 214
Target Start/End: Complemental strand, 2176388 - 2176353
Alignment:
| Q |
179 |
gttttacttctaagaacaatttattcgagtcaatca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2176388 |
gttttacttctaagaacaatttattcgagtcaatca |
2176353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University