View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17061_high_50 (Length: 232)
Name: NF17061_high_50
Description: NF17061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17061_high_50 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 213
Target Start/End: Complemental strand, 29062814 - 29062619
Alignment:
| Q |
18 |
tgtgatgatggtttttctctatttgtgtttgttggacttagaaatgtggagatgcctattggaaattgagcttcctcaaggaaagagagaagagaaggga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29062814 |
tgtgatgatggtttttctctatttgtgtttgttggacttagaaatgtggagatgcctattggaaattgagcttcctcaaggaaagagagaagagaaggga |
29062715 |
T |
|
| Q |
118 |
attatttgaattgaatgatggatgtttgccaaacattgtatttatagagtttgagtaaataattattttactcattgaatatgggaaacaatatcc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29062714 |
attatttgaattgaatgatggatgtttgccaaacattgtatttatagagcttgagtaaataattattttactctttgaatatgggaaacaatatcc |
29062619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University