View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17061_high_51 (Length: 231)
Name: NF17061_high_51
Description: NF17061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17061_high_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 4779855 - 4780087
Alignment:
| Q |
1 |
tcatcagccaaataccaagattgctcnnnnnnn-ctacgtcacaattttaggactgtttttgcaatagatatccacataactgaatggaa--tgtagaca |
97 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |||||||||||||||||||||| ||| |||| |
|
|
| T |
4779855 |
tcatcagccaaataccaagattgctcaaaaaaaactacgtcacaatgttaggactgtttttgcaataaatatccacataactgaatggaaaatgttgaca |
4779954 |
T |
 |
| Q |
98 |
ttttgaataactgaaaggatgacannnnnnnn-aatcatgcatgggagaatgaaagaagaatatttctttttgttattcaaatttggtctgagataagta |
196 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4779955 |
ttttgaataaccgaaaggatgacatttttttttaatcatgcatgggacaatgaaagaagaatatttctttttgttattcaaatttggtctgagataagta |
4780054 |
T |
 |
| Q |
197 |
aagaataatcaataattattttatttagaaatc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4780055 |
aagaataatcaataattattttatttagaaatc |
4780087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University