View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17061_low_40 (Length: 278)
Name: NF17061_low_40
Description: NF17061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17061_low_40 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 11 - 278
Target Start/End: Original strand, 56167281 - 56167548
Alignment:
| Q |
11 |
gtgagatgaatgttctttatcaaaaccctcatgaagctcagcttctttttggccgagggtttagagctggaatggatcgccgtgagcagaagaagcttgc |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56167281 |
gtgatatgaatgttctttatcaaaaccctcatgaagctcagcttctttttggccgagggtttagagctggaatggatcgccgtgagcagaagaagcttgc |
56167380 |
T |
 |
| Q |
111 |
ggcaaagcacgagaaagagatgagggatcagattaggaagaaggatggtgtcgaggagaagcccgaggaagctgatgctcagcggcgtaaggaggaggct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56167381 |
ggcaaagcacgagaaagagatgagggatcagattaggaagaaggatggtgtcgaggagaagcccgaggaagctgatgctcagcggcgtaaggaggaggct |
56167480 |
T |
 |
| Q |
211 |
gctgatgcttatgatacgtttgatatgagggttgatcgtcattggagtgagaagaagcttgaggaaat |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56167481 |
gctgatgcttatgatacgtttgatatgagggttgatcgtcattggagtgagaagaagcttgaggaaat |
56167548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 18 - 278
Target Start/End: Complemental strand, 708416 - 708156
Alignment:
| Q |
18 |
gaatgttctttatcaaaaccctcatgaagctcagcttctttttggccgagggtttagagctggaatggatcgccgtgagcagaagaagcttgcggcaaag |
117 |
Q |
| |
|
||||| ||||||| ||||||||||| |||||||||||||||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
708416 |
gaatgatctttatgaaaaccctcatacggctcagcttctttttggccgagggtttatcgctggaatggatcgtcgtgaacagaagaagcttgcggcaaag |
708317 |
T |
 |
| Q |
118 |
cacgagaaagagatgagggatcagattaggaagaaggatggtgtcgaggagaagcccgaggaagctgatgctcagcggcgtaaggaggaggctgctgatg |
217 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||| |||| || |||||||||||||||| |
|
|
| T |
708316 |
caggagaaagagatgagggatcagattaggaagaaggatggtgtggaggagaagcctgaggaggctgatgctcaaaggcggaaagaggaggctgctgatg |
708217 |
T |
 |
| Q |
218 |
cttatgatacgtttgatatgagggttgatcgtcattggagtgagaagaagcttgaggaaat |
278 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
708216 |
cttatgatgcttttgatatgagggttgatcgtcattggagtgagaagaatcttgaggaaat |
708156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University