View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17061_low_43 (Length: 266)
Name: NF17061_low_43
Description: NF17061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17061_low_43 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 10 - 266
Target Start/End: Complemental strand, 45676754 - 45676498
Alignment:
| Q |
10 |
atgaatcatggccgtcnnnnnnntgatgtgtcacctttggtaggtaggacccaaagtagtattatgtggaatgtctcgtgaattagaaagtcagatatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45676754 |
atgaatcatggccgtcaaaaaaatgatgtgtcacctttggtaggtaggacccaaagtagtattatgtggaatgtctcgtgaattagaaagtcagatatat |
45676655 |
T |
|
| Q |
110 |
aaattcaaaatgacaatgtccaatcataactttttcttcctctccaaagtttccttcttctatttatttcactttctatatatcaacttgccattttatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45676654 |
aaattcaaaatgacaatgtccaatcataactttttcttcctctccaaagtttccttcttctatttatttcactttctatatatcaacttgccattttatt |
45676555 |
T |
|
| Q |
210 |
tctcaaaacctttttaacttctaagttctaacccttcttcactactataataattca |
266 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45676554 |
tctcaaaacatttttaacttctaagttctaacccttcttcactactataataattca |
45676498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University