View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17061_low_49 (Length: 239)
Name: NF17061_low_49
Description: NF17061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17061_low_49 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 12)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 76 - 142
Target Start/End: Complemental strand, 10491434 - 10491368
Alignment:
| Q |
76 |
tgcaactacttttggatggtgtgcttaactatttgtcgtgtccaactgaagctattaatgaggaaaa |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10491434 |
tgcaactacttttggatggtgtgcttaactatttgccgtgtccaactgaagctattaatgaggaaaa |
10491368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 74 - 134
Target Start/End: Complemental strand, 10505555 - 10505495
Alignment:
| Q |
74 |
gttgcaactacttttggatggtgtgcttaactatttgtcgtgtccaactgaagctattaat |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |||| |
|
|
| T |
10505555 |
gttgcaactacttttggatggtgtgcttaattatttgccgtgtccaactgaagctagtaat |
10505495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 76 - 134
Target Start/End: Original strand, 7483220 - 7483278
Alignment:
| Q |
76 |
tgcaactacttttggatggtgtgcttaactatttgtcgtgtccaactgaagctattaat |
134 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
7483220 |
tgcaactactttttgctggtgtgcttaactatttgccgtgtccaactgaagctagtaat |
7483278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 4 - 72
Target Start/End: Complemental strand, 10492832 - 10492763
Alignment:
| Q |
4 |
gcaatttgtggggcaaccatagcacagaaatttgtgccggttttcat-ggtagcgcattcaagtataagg |
72 |
Q |
| |
|
|||||| || |||||||||||||||| |||||||| ||||||||||| ||||| |||||||||||||||| |
|
|
| T |
10492832 |
gcaattcgtagggcaaccatagcacataaatttgtaccggttttcatgggtagtgcattcaagtataagg |
10492763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 78 - 134
Target Start/End: Complemental strand, 10462304 - 10462248
Alignment:
| Q |
78 |
caactacttttggatggtgtgcttaactatttgtcgtgtccaactgaagctattaat |
134 |
Q |
| |
|
|||||| ||||||||||||| ||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
10462304 |
caactaattttggatggtgtacttaattatttgccgtgtccaactgaagctattaat |
10462248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 78 - 134
Target Start/End: Complemental strand, 10471398 - 10471342
Alignment:
| Q |
78 |
caactacttttggatggtgtgcttaactatttgtcgtgtccaactgaagctattaat |
134 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||| |||||||||||||||||| |||| |
|
|
| T |
10471398 |
caactacttttggatggtgtacttaattatttgccgtgtccaactgaagctagtaat |
10471342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 78 - 134
Target Start/End: Complemental strand, 10543596 - 10543540
Alignment:
| Q |
78 |
caactacttttggatggtgtgcttaactatttgtcgtgtccaactgaagctattaat |
134 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||| |||||||||||||||||| |||| |
|
|
| T |
10543596 |
caactacttttggatggtgtacttaattatttgccgtgtccaactgaagctagtaat |
10543540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 14 - 72
Target Start/End: Original strand, 7476577 - 7476636
Alignment:
| Q |
14 |
gggcaaccatagcacagaaatttgtgccggttttcat-ggtagcgcattcaagtataagg |
72 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||| ||||| |||||||||||||||| |
|
|
| T |
7476577 |
gggcaactatagcacagaaatttgtaccggttttcatgggtagtgcattcaagtataagg |
7476636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 82 - 134
Target Start/End: Complemental strand, 10516689 - 10516637
Alignment:
| Q |
82 |
tacttttggatggtgtgcttaactatttgtcgtgtccaactgaagctattaat |
134 |
Q |
| |
|
|||||||||||||| | ||||| |||||| |||||||||||||||||| |||| |
|
|
| T |
10516689 |
tacttttggatggtctacttaattatttgccgtgtccaactgaagctagtaat |
10516637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 78 - 134
Target Start/End: Complemental strand, 27966462 - 27966406
Alignment:
| Q |
78 |
caactacttttggatggtgtgcttaactatttgtcgtgtccaactgaagctattaat |
134 |
Q |
| |
|
|||||||||||||||||||| |||| |||||| ||||||||| |||||||| |||| |
|
|
| T |
27966462 |
caactacttttggatggtgtaattaattatttgccgtgtccaattgaagctagtaat |
27966406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 78 - 134
Target Start/End: Original strand, 28106214 - 28106270
Alignment:
| Q |
78 |
caactacttttggatggtgtgcttaactatttgtcgtgtccaactgaagctattaat |
134 |
Q |
| |
|
|||||||||||||||||||| |||| |||||| ||||||||| |||||||| |||| |
|
|
| T |
28106214 |
caactacttttggatggtgtaattaattatttgccgtgtccaattgaagctagtaat |
28106270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 76 - 134
Target Start/End: Complemental strand, 10486986 - 10486928
Alignment:
| Q |
76 |
tgcaactacttttggatggtgtgcttaactatttgtcgtgtccaactgaagctattaat |
134 |
Q |
| |
|
|||||||||||||||||||| ||| ||| |||| |||||||||| |||||||| |||| |
|
|
| T |
10486986 |
tgcaactacttttggatggtatgcgtaagtattgttcgtgtccaattgaagctagtaat |
10486928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 78 - 127
Target Start/End: Complemental strand, 33601117 - 33601068
Alignment:
| Q |
78 |
caactacttttggatggtgtgcttaactatttgtcgtgtccaactgaagc |
127 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
33601117 |
caaccacttttggatggtgtgcttaataatttgccgtgtccaactgaagc |
33601068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University