View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17061_low_49 (Length: 239)

Name: NF17061_low_49
Description: NF17061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17061_low_49
NF17061_low_49
[»] chr2 (12 HSPs)
chr2 (76-142)||(10491368-10491434)
chr2 (74-134)||(10505495-10505555)
chr2 (76-134)||(7483220-7483278)
chr2 (4-72)||(10492763-10492832)
chr2 (78-134)||(10462248-10462304)
chr2 (78-134)||(10471342-10471398)
chr2 (78-134)||(10543540-10543596)
chr2 (14-72)||(7476577-7476636)
chr2 (82-134)||(10516637-10516689)
chr2 (78-134)||(27966406-27966462)
chr2 (78-134)||(28106214-28106270)
chr2 (76-134)||(10486928-10486986)
[»] chr5 (1 HSPs)
chr5 (78-127)||(33601068-33601117)


Alignment Details
Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 12)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 76 - 142
Target Start/End: Complemental strand, 10491434 - 10491368
Alignment:
76 tgcaactacttttggatggtgtgcttaactatttgtcgtgtccaactgaagctattaatgaggaaaa 142  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
10491434 tgcaactacttttggatggtgtgcttaactatttgccgtgtccaactgaagctattaatgaggaaaa 10491368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 74 - 134
Target Start/End: Complemental strand, 10505555 - 10505495
Alignment:
74 gttgcaactacttttggatggtgtgcttaactatttgtcgtgtccaactgaagctattaat 134  Q
    |||||||||||||||||||||||||||||| |||||| |||||||||||||||||| ||||    
10505555 gttgcaactacttttggatggtgtgcttaattatttgccgtgtccaactgaagctagtaat 10505495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 76 - 134
Target Start/End: Original strand, 7483220 - 7483278
Alignment:
76 tgcaactacttttggatggtgtgcttaactatttgtcgtgtccaactgaagctattaat 134  Q
    ||||||||||||| | ||||||||||||||||||| |||||||||||||||||| ||||    
7483220 tgcaactactttttgctggtgtgcttaactatttgccgtgtccaactgaagctagtaat 7483278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 4 - 72
Target Start/End: Complemental strand, 10492832 - 10492763
Alignment:
4 gcaatttgtggggcaaccatagcacagaaatttgtgccggttttcat-ggtagcgcattcaagtataagg 72  Q
    |||||| || |||||||||||||||| |||||||| ||||||||||| ||||| ||||||||||||||||    
10492832 gcaattcgtagggcaaccatagcacataaatttgtaccggttttcatgggtagtgcattcaagtataagg 10492763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 78 - 134
Target Start/End: Complemental strand, 10462304 - 10462248
Alignment:
78 caactacttttggatggtgtgcttaactatttgtcgtgtccaactgaagctattaat 134  Q
    |||||| ||||||||||||| ||||| |||||| |||||||||||||||||||||||    
10462304 caactaattttggatggtgtacttaattatttgccgtgtccaactgaagctattaat 10462248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 78 - 134
Target Start/End: Complemental strand, 10471398 - 10471342
Alignment:
78 caactacttttggatggtgtgcttaactatttgtcgtgtccaactgaagctattaat 134  Q
    |||||||||||||||||||| ||||| |||||| |||||||||||||||||| ||||    
10471398 caactacttttggatggtgtacttaattatttgccgtgtccaactgaagctagtaat 10471342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 78 - 134
Target Start/End: Complemental strand, 10543596 - 10543540
Alignment:
78 caactacttttggatggtgtgcttaactatttgtcgtgtccaactgaagctattaat 134  Q
    |||||||||||||||||||| ||||| |||||| |||||||||||||||||| ||||    
10543596 caactacttttggatggtgtacttaattatttgccgtgtccaactgaagctagtaat 10543540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 14 - 72
Target Start/End: Original strand, 7476577 - 7476636
Alignment:
14 gggcaaccatagcacagaaatttgtgccggttttcat-ggtagcgcattcaagtataagg 72  Q
    ||||||| ||||||||||||||||| ||||||||||| ||||| ||||||||||||||||    
7476577 gggcaactatagcacagaaatttgtaccggttttcatgggtagtgcattcaagtataagg 7476636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 82 - 134
Target Start/End: Complemental strand, 10516689 - 10516637
Alignment:
82 tacttttggatggtgtgcttaactatttgtcgtgtccaactgaagctattaat 134  Q
    |||||||||||||| | ||||| |||||| |||||||||||||||||| ||||    
10516689 tacttttggatggtctacttaattatttgccgtgtccaactgaagctagtaat 10516637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 78 - 134
Target Start/End: Complemental strand, 27966462 - 27966406
Alignment:
78 caactacttttggatggtgtgcttaactatttgtcgtgtccaactgaagctattaat 134  Q
    ||||||||||||||||||||  |||| |||||| ||||||||| |||||||| ||||    
27966462 caactacttttggatggtgtaattaattatttgccgtgtccaattgaagctagtaat 27966406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 78 - 134
Target Start/End: Original strand, 28106214 - 28106270
Alignment:
78 caactacttttggatggtgtgcttaactatttgtcgtgtccaactgaagctattaat 134  Q
    ||||||||||||||||||||  |||| |||||| ||||||||| |||||||| ||||    
28106214 caactacttttggatggtgtaattaattatttgccgtgtccaattgaagctagtaat 28106270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 76 - 134
Target Start/End: Complemental strand, 10486986 - 10486928
Alignment:
76 tgcaactacttttggatggtgtgcttaactatttgtcgtgtccaactgaagctattaat 134  Q
    |||||||||||||||||||| ||| ||| ||||  |||||||||| |||||||| ||||    
10486986 tgcaactacttttggatggtatgcgtaagtattgttcgtgtccaattgaagctagtaat 10486928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 78 - 127
Target Start/End: Complemental strand, 33601117 - 33601068
Alignment:
78 caactacttttggatggtgtgcttaactatttgtcgtgtccaactgaagc 127  Q
    |||| |||||||||||||||||||||  ||||| ||||||||||||||||    
33601117 caaccacttttggatggtgtgcttaataatttgccgtgtccaactgaagc 33601068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University