View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17061_low_50 (Length: 237)
Name: NF17061_low_50
Description: NF17061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17061_low_50 |
 |  |
|
| [»] scaffold0246 (1 HSPs) |
 |  |  |
|
| [»] scaffold0128 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
| [»] scaffold0154 (2 HSPs) |
 |  |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |  |
|
| [»] scaffold0608 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
| [»] scaffold0063 (1 HSPs) |
 |  |  |
|
| [»] scaffold0366 (1 HSPs) |
 |  |  |
|
| [»] scaffold0690 (1 HSPs) |
 |  |  |
|
| [»] scaffold0121 (2 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
| [»] scaffold0117 (1 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |  |
|
| [»] scaffold1787 (1 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold0519 (1 HSPs) |
 |  |  |
|
| [»] scaffold0445 (1 HSPs) |
 |  |  |
|
| [»] scaffold0294 (1 HSPs) |
 |  |  |
|
| [»] scaffold0288 (1 HSPs) |
 |  |  |
|
| [»] scaffold0038 (1 HSPs) |
 |  |  |
|
| [»] scaffold0116 (1 HSPs) |
 |  |  |
|
| [»] scaffold0068 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 9e-88; HSPs: 119)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 41458329 - 41458550
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaattnnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41458329 |
atattatatgcaggggctgggtttcgaacctcggacactccacttctccacatttaaatgtgtgagcttcagccactagacgacttgacaattaaaaaaa |
41458428 |
T |
 |
| Q |
101 |
nnngatccactcacatatgtataggcatgatcactatatgatcaagattagattgtgaacaacttcagaggaatttatattgatttatctaaataaccct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
41458429 |
aa-gatccactcacatatgtataggcatgatcactatatgatcaagattagattgtgaacaacttcagaggaatttctattgatttttctaaataaccct |
41458527 |
T |
 |
| Q |
201 |
actataaaaagagaagacatttg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
41458528 |
actataaaaagagaagacatttg |
41458550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 2792813 - 2792901
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttga |
88 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||| |||||||||| |||||| |||||||||| |||||||||||| |||||| |
|
|
| T |
2792813 |
atattatatgcaggggccggggttcgaaccccggacactccacttctccacaatttaattgtgtgagctccaaccactagactacttga |
2792901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 24458351 - 24458439
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||||||| || ||||||||||||| ||||||||||||||||||||| |||||||||| | ||||||||| ||||||| |
|
|
| T |
24458351 |
atattatatgcaggggccggggttcgaaccccggatactcaacttctccacatttaattgtgtgagctctagccactagactacttgac |
24458439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 94547 - 94456
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || ||| |||||||||||||||||| ||||||||||| ||||| |||||||||| ||||||||| | ||||||||| |
|
|
| T |
94547 |
atattatatgcaggagccggagttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactaggctacttgacaa |
94456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 11875920 - 11876009
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||| ||||||||||| ||||| |||||||||| ||||||||| | ||||||| |
|
|
| T |
11875920 |
atattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactaggctacttgac |
11876009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 11890927 - 11891016
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||| ||||||||||| ||||| |||||||||| ||||||||| | ||||||| |
|
|
| T |
11890927 |
atattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactaggctacttgac |
11891016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 6942567 - 6942476
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
6942567 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactagactacttgacaa |
6942476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 44444578 - 44444657
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactaga |
80 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| | ||||||||||| |||| |||||||| || | |||||||| |
|
|
| T |
44444578 |
atattatatgcaggggctggggttcgaaccccggacaccccacttctccacaattaattgtgtgagttttagccactaga |
44444657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 41616402 - 41616324
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||||||||||||| || ||||||||||||| |||| ||||||||||||| |||||||||||| || ||||||| |
|
|
| T |
41616402 |
atattatatgcaggggccggggttcgaaccccggatactccacttctccacattataatgtgtgagctccagccactag |
41616324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 4 - 89
Target Start/End: Complemental strand, 43856415 - 43856329
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||| |||||||||| |||||| |||| ||||| ||||||||| ||||||||| |
|
|
| T |
43856415 |
ttatatgcaggggccggggttcgaaccccggacactccacttctccacaatttaattgtgagagctctaaccactaggcgacttgac |
43856329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 34413096 - 34413185
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| ||||||||| | ||||||| |
|
|
| T |
34413096 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactaggctacttgac |
34413185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 38344083 - 38344172
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| ||||| |||||||||| ||||||| ||||||||||| ||||| |||||||||| | ||||||||| ||||||| |
|
|
| T |
38344083 |
atattatatgcaggagctggggttcgaaccccagacactccacttctccacaattaaattgtgtgagctctagccactagactacttgac |
38344172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 4 - 79
Target Start/End: Original strand, 31024331 - 31024407
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| | |||||||||||||| ||||||||||||| || ||||||| |
|
|
| T |
31024331 |
ttatacgcaggggctggggttcgaaccccggacaccccacttctccacatttaaaatgtgtgagctccagccactag |
31024407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 42035370 - 42035438
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||| |||||||||| |||||| |||||||||| |
|
|
| T |
42035370 |
atattatatgcaggggctggggttcgaaccccagacactctacttctccacaatttaattgtgtgagct |
42035438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 5038592 - 5038671
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||| ||||| ||||||||| |||||||| ||||||||||| ||||| |||||||||| || ||||||| |
|
|
| T |
5038592 |
atattatatgcaggagctggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctccagccactag |
5038671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 5683788 - 5683855
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||| | ||||||||||||||| ||||||||||| |
|
|
| T |
5683788 |
atattatatgcaggggttggggttcgaaccccagacaccctacttctccacatttatatgtgtgagct |
5683855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 16449159 - 16449250
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||| |||||||||| |||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
16449159 |
atattatatgcaggggttggggttcgaaccccagacactccacttctccacaatttaattgtgtgagctctagccactaggctacttgacaa |
16449250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 29514660 - 29514751
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| ||||| ||| |||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
29514660 |
atattatatgcaggagctggggttcaaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
29514751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 38955230 - 38955139
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||| ||||||| ||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
38955230 |
atattatatgcaggggccggggttcgaaccccggacactcgacttctctacaattaaattgtgtgagctctatccactaggctacttgacaa |
38955139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 43284002 - 43283911
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| | ||||||||| ||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
43284002 |
atattatatgcaggagccggggttcgaaccccggacactccatttctccacaattaaattgtgtgagctctagccactagactacttgacaa |
43283911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 43980349 - 43980258
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||| |||||| ||||||||||| | |||||| | ||||||||| |
|
|
| T |
43980349 |
atattatatgcagggatcggggttcgaaccccggacactcaacttctccacaatttaattgtgtgagctttagccactacgctacttgacaa |
43980258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 22274647 - 22274557
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||| | ||||||||||| |||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
22274647 |
atattatatgcaggagccggggttcgaaccccggacaccccacttctccacaattaattgtgtgagctctagccactaggctacttgacaa |
22274557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 31712583 - 31712673
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||| |||||| | |||||||||||||||| | ||||||||||||||| ||||||||||| | ||||||| | ||||||||| |
|
|
| T |
31712583 |
atattatatgtaggggccagggttcgaaccccggacaccccacttctccacatttatatgtgtgagctctagccactaggctacttgacaa |
31712673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 4 - 89
Target Start/End: Complemental strand, 43085256 - 43085170
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||| ||||||||||| ||||| ||||| |||| ||||||||| | ||||||| |
|
|
| T |
43085256 |
ttatatgcaggggccggggttcgaaccccggacactccacttctccacaattaaattgtgtaagctctaaccactaggctacttgac |
43085170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 2787117 - 2787028
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
2787117 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
2787028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 6659323 - 6659392
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagctt |
69 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| ||||||||||| |
|
|
| T |
6659323 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctt |
6659392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 6739725 - 6739794
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagctt |
69 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| ||||||||||| |
|
|
| T |
6739725 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctt |
6739794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 8969129 - 8969221
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa--tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| ||||| |||||||| ||||||||| ||||||||||| ||||| |||||||||| |||||| |||| | ||||||| |
|
|
| T |
8969129 |
atattatatgcaggagctggggttcgaacctcggacactccacttctccacaattaaaattgtgtgagctctaaccaccagactatttgacaa |
8969221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 10736910 - 10736821
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
10736910 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
10736821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 12770408 - 12770469
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| || |||||||||||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
12770408 |
tatgcaggggccggggttcgaaccccggacaccccacttctccacatttaattgtgtgagct |
12770469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 23 - 91
Target Start/End: Complemental strand, 13647471 - 13647402
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
13647471 |
ttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagccactagactacttgacaa |
13647402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 23 - 91
Target Start/End: Complemental strand, 13747896 - 13747827
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
13747896 |
ttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagccactagactacttgacaa |
13747827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 23178927 - 23178838
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||| |||||| ||| |||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
23178927 |
atattatatgcaggggccggggttcgaaccccggacactccacttcttcacaatttaattgtgtgagctctagccactaggctacttgac |
23178838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 29716894 - 29716983
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| |||||| || | ||||||| |
|
|
| T |
29716894 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccacgaggctacttgac |
29716983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 34472331 - 34472420
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| | ||| |||||||||| ||||||| |||| |||||| ||||| |||||||||| ||||||||||| ||||||| |
|
|
| T |
34472331 |
atattatatgcaggagttggggttcgaaccccagacactccacttttccacaattaaattgtgtgagctctaaccactagactacttgac |
34472420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 37717397 - 37717486
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
37717397 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
37717486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 41272134 - 41272195
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| ||||||| | |||||| | ||||||||||||||||||||||||||| |
|
|
| T |
41272134 |
tatgcaggggctggggttcgaactctggacacaccacttctccacatttaaatgtgtgagct |
41272195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 1337151 - 1337083
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
1337151 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
1337083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 23 - 91
Target Start/End: Original strand, 2114939 - 2115007
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||| |||||||| | |||||||||||||||| |||||| ||| || ||||||||| ||||||||| |
|
|
| T |
2114939 |
ttcgaactccggacaccccacttctccacatttaattgtgtgggctccagccactagactacttgacaa |
2115007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 6280514 - 6280582
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccaca-tttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
6280514 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacagtttaattgtgtgagct |
6280582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 13406634 - 13406702
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || ||| ||||||||| |||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
13406634 |
atattatatgcaggagccggagttcgaaccctggacactccacttctccacaattaaattgtgtgagct |
13406702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 4 - 91
Target Start/End: Original strand, 34873123 - 34873211
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||| || |||||||| ||||||| | |||||||||||||| ||||||||||||| || ||||||||| | ||||||| |
|
|
| T |
34873123 |
ttatatgcaggggtcggggttcgaacctcggacaccccacttctccacatttaaaatgtgtgagctccagccactagactatttgacaa |
34873211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 34894403 - 34894471
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| | ||||||||||| ||||| |||||||||| |
|
|
| T |
34894403 |
atattatatgcaggggccggggttcgaaccccggacaccccacttctccacagttaaattgtgtgagct |
34894471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 37290956 - 37291024
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| | ||||||||||| ||||| |||||||||| |
|
|
| T |
37290956 |
atattatatgcaggggccggcgttcgaaccccggacaccccacttctccacaattaaattgtgtgagct |
37291024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 4 - 79
Target Start/End: Original strand, 37708728 - 37708804
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||| || ||||||||||||||| | |||||||||||||| ||||||||||||| || ||||||| |
|
|
| T |
37708728 |
ttatatgcaggggccggggttcgaaccccggacatcccacttctccacatttaaaatgtgtgagctccagccactag |
37708804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 1632476 - 1632397
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||| | || |||||||||||||||||| ||||||||||| ||||| |||||||||| ||||||||| |
|
|
| T |
1632476 |
atattatatgcaggagtcggggttcgaaccccggacactctacttctccacaattaaattgtgtgagctctaaccactag |
1632397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 7765677 - 7765768
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || |||||||||| ||||||| | ||||||||| ||||| ||||||||||| ||||| ||| | ||||||||| |
|
|
| T |
7765677 |
atattatatgcaggagccggggttcgaaccccagacactccatttctccacaattaaattgtgtgagctttaaccaataggctacttgacaa |
7765768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 7797164 - 7797255
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| ||| |||||| | ||||||| | ||||||||| |
|
|
| T |
7797164 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtatgagctatagccactaggctacttgacaa |
7797255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 7816437 - 7816528
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || |||||||| ||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
7816437 |
atattatatgcaggagccggggttcgaacctcggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
7816528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 10083197 - 10083288
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaat |
92 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||| | ||||||||| ||||| ||||||||||| | ||||||||| | |||||||| |
|
|
| T |
10083197 |
atattatatgcaggggtcgaggttcgaaccccggacaccccacttctccatatttatatgtgtgagctctagccactagactaattgacaat |
10083288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 10200717 - 10200626
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||| | ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
10200717 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccataattaaattgtgtgagctatagccactaggctacttgacaa |
10200626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 13 - 91
Target Start/End: Original strand, 11491843 - 11491922
Alignment:
| Q |
13 |
ggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||| |||||| ||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||||| |||| |||| |
|
|
| T |
11491843 |
ggggccggattttgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactagactacttaacaa |
11491922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 14876638 - 14876547
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || |||||||| ||||||||| |||||||||| || ||| |||||||||| ||||||||| | ||||||||| |
|
|
| T |
14876638 |
atattatatgcaggagccggggttcgaacctcggacactccacttctccacaatataattgtgtgagctctaaccactaggctacttgacaa |
14876547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 17072599 - 17072508
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||||| || ||||||||||| |||| | ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
17072599 |
atattatatgcaggggccggggttcgaaccccgaacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
17072508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 17575672 - 17575763
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||||| || ||||||||||| |||| | ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
17575672 |
atattatatgcaggggccggggttcgaaccccgaacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
17575763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 31450993 - 31450902
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || ||||||| |||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
31450993 |
atattatatgcaggagccggggttcgaactccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
31450902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 33810677 - 33810752
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccacta |
78 |
Q |
| |
|
|||||||||||||| || ||| |||||||||||| | |||||||||||||| ||||||||||||| || |||||| |
|
|
| T |
33810677 |
ttatatgcaggggccggggttcaaaccccggacaccccacttctccacatttaaaatgtgtgagctccagccacta |
33810752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 34266046 - 34266137
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| | ||| |||||||| ||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
34266046 |
atattatatgcaggagttggggttcgaacctcggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
34266137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 4 - 59
Target Start/End: Original strand, 37669723 - 37669778
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
|||||||||| ||||||| |||||||||| ||||||| ||||||||||| |||||| |
|
|
| T |
37669723 |
ttatatgcagtggctggagttcgaaccccagacactccacttctccacaattaaat |
37669778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 5332950 - 5333036
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgactt |
86 |
Q |
| |
|
|||||||||||||| | || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||||| |||| |
|
|
| T |
5332950 |
atattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactagactactt |
5333036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 4 - 89
Target Start/End: Original strand, 5570931 - 5571017
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||| | ||||||||||| ||||| | |||||||| | ||||||||| ||||||| |
|
|
| T |
5570931 |
ttatatgcaggggtcggagttcgaaccccggacaccccacttctccacaattaaattatgtgagctctagccactagactacttgac |
5571017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 4 - 89
Target Start/End: Complemental strand, 18926168 - 18926082
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||| ||||||||||| ||||| |||||||||| | ||| ||||| ||||||| |
|
|
| T |
18926168 |
ttatatgcaggggcagggattcgaaccccggacacttcacttctccacaattaaattgtgtgagctctagccattagactacttgac |
18926082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 23858231 - 23858297
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgag |
66 |
Q |
| |
|
||||||||||||||||| ||| ||||||||| |||||||| | |||||||| |||||| |||||||| |
|
|
| T |
23858231 |
atattatatgcaggggccggagttcgaaccctggacactccaattctccacaatttaattgtgtgag |
23858297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 26022281 - 26022367
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgactt |
86 |
Q |
| |
|
||||||||||||||||| || |||||||||| ||||||| |||||||||| |||||| ||||||| || | ||||||||| |||| |
|
|
| T |
26022281 |
atattatatgcaggggccggggttcgaaccccagacactccacttctccacaatttaattgtgtgacctctagccactagactactt |
26022367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 7 - 57
Target Start/End: Complemental strand, 34812557 - 34812507
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaa |
57 |
Q |
| |
|
|||||||||||||| |||||||||||||||| | |||||||||||||||| |
|
|
| T |
34812557 |
tatgcaggggctggggttcgaaccccggacaccccacttctccacatttaa |
34812507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 5328603 - 5328514
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| |||||||||| ||| ||||||||||||| | ||||||| | ||||||| |
|
|
| T |
5328603 |
atattatatgcaggggccggggttcgaaccccggacacctcacttctccacaattaaaatgtgtgagctctagccactaggctacttgac |
5328514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 7194296 - 7194353
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa |
58 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
7194296 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaa |
7194353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 8265302 - 8265391
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||| |||||||||| |||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
8265302 |
atattatatgcaggggtcagggttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagccactaggctacttgac |
8265391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 17698556 - 17698645
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||| ||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
17698556 |
atattatatgcaggagccggggttcgaatcccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
17698645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 24480857 - 24480768
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||| | ||||||||||| ||||| | |||||||| | ||||||||| ||||||| |
|
|
| T |
24480857 |
atattatatgcaggggctggggttcgaaccttggacaccccacttctccacaattaaattatgtgagctctagccactagactacttgac |
24480768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 28909499 - 28909588
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||| ||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
28909499 |
atattacatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
28909588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 38219604 - 38219515
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| | || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
38219604 |
atattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
38219515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 43186887 - 43186976
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || | |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
43186887 |
atattatatgcaggagccaggattcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
43186976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 23 - 79
Target Start/End: Complemental strand, 44053454 - 44053397
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||||| | |||||||||||||| ||||||||||||| || ||||||| |
|
|
| T |
44053454 |
ttcgaaccccggacaccccacttctccacatttaaaatgtgtgagctccagccactag |
44053397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 23 - 86
Target Start/End: Original strand, 150506 - 150570
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatt-taaatgtgtgagcttcaaccactagacgactt |
86 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||| |||| ||||||||||| ||||||||| |||| |
|
|
| T |
150506 |
ttcgaatccctgacactcaacttctccacattcaaaatatgtgagcttcagccactagactactt |
150570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 79
Target Start/End: Original strand, 481051 - 481123
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||||||| | |||||||||||||||| | |||||||||||||||| |||||||| || | ||||||| |
|
|
| T |
481051 |
tatgcaggggccgcggttcgaaccccggacaccccacttctccacatttaattgtgtgagatttagccactag |
481123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 10573135 - 10573203
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| |||||| |||||||||| |||||| |||| ||||| |
|
|
| T |
10573135 |
atattatatgcaggggttggggttcgaaccccgaacactccacttctccacaatttaattgtgcgagct |
10573203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 91
Target Start/End: Complemental strand, 11289456 - 11289368
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||| ||||||||| ||||||||| ||||| || ||||||||||| ||||| | ||| |||| ||||||||||| ||||||||| |
|
|
| T |
11289456 |
ttatatgtaggggctggggttcgaaccctggacattccacttctccacaattaaattatgtcagctctaaccactagactacttgacaa |
11289368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 13450483 - 13450563
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagac |
81 |
Q |
| |
|
||||||||||||| ||| | |||||||||| ||||||| ||||||||||| |||||| ||||||| ||||||||||| |
|
|
| T |
13450483 |
atattatatgcagaggccagggttcgaaccccagacactccacttctccacaattaaattggtgagctctaaccactagac |
13450563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 80
Target Start/End: Original strand, 14583235 - 14583311
Alignment:
| Q |
5 |
tatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaa-atgtgtgagcttcaaccactaga |
80 |
Q |
| |
|
|||||||||||||||| |||||||| || |||| | ||||||||||||| || ||||||||||| || |||||||| |
|
|
| T |
14583235 |
tatatgcaggggctggggttcgaaccacgaacaccccacttctccacattaaatatgtgtgagctccagccactaga |
14583311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 23435269 - 23435201
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccaca-tttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || ||||||||||||| |||| ||||||||||| ||||| |||||||||| |
|
|
| T |
23435269 |
atattatatgcaggagccggggttcgaaccccggatactccacttctccacagtttaattgtgtgagct |
23435201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 79
Target Start/End: Complemental strand, 36035212 - 36035136
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||||||||| || |||||||| ||||||| | |||||||||||||| ||||||||||||| || ||||||| |
|
|
| T |
36035212 |
ttatatgcaggggtcggggttcgaacctcggacaccccacttctccacatttaaaatgtgtgagctccagccactag |
36035136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 88
Target Start/End: Complemental strand, 39674091 - 39674007
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttga |
88 |
Q |
| |
|
||||||||||||| ||| ||||||||| |||||| | |||||| ||||||||| ||| |||||| | ||||||||| |||||| |
|
|
| T |
39674091 |
ttatatgcaggggttggggttcgaaccctggacaccccacttcttcacatttaattgtatgagctctagccactagactacttga |
39674007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 42880982 - 42881050
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||| ||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
42880982 |
atattatatgtaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
42881050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 91
Target Start/End: Complemental strand, 44673681 - 44673593
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||| || |||||||||| ||||||| |||| |||||| ||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
44673681 |
ttatatgcaggggtcggggttcgaaccccagacactccacttttccacaattaaattgtgtgagctctagccactagactacttgacaa |
44673593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 35 - 78
Target Start/End: Original strand, 550369 - 550412
Alignment:
| Q |
35 |
acactcaacttctccacatttaaatgtgtgagcttcaaccacta |
78 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
550369 |
acactccacttcttcacatttaaatgtgtgagctccaaccacta |
550412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 68
Target Start/End: Complemental strand, 2908123 - 2908060
Alignment:
| Q |
5 |
tatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||||| || ||||||||| |||||| | |||||||| |||| ||||||||||||| |
|
|
| T |
2908123 |
tatatgcaggggccggggttcgaaccctggacaccccacttctccgcattaaaatgtgtgagct |
2908060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 8698616 - 8698549
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||| ||||| ||| |||||| ||||||||| | |||||| ||||||||||| |||||||| |
|
|
| T |
8698616 |
atattatatgtaggggttggggttcgaatcccggacaccccacttcttcacatttaaatatgtgagct |
8698549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 89
Target Start/End: Complemental strand, 13059207 - 13059124
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||| || |||||||||| ||||| | |||||||||||||| ||||||||| ||| || ||||||| | ||||||| |
|
|
| T |
13059207 |
tatgcaggggcaggggttcgaacccctgacaccccacttctccacatttaaaatgtgtgtgctccagccactaggctacttgac |
13059124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 6 - 68
Target Start/End: Original strand, 23261340 - 23261403
Alignment:
| Q |
6 |
atatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||| | || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
23261340 |
atatgcagggaccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
23261403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 23 - 89
Target Start/End: Original strand, 39169541 - 39169608
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
39169541 |
ttcgaaccccagacactcaacttctccacaatttaattgtgtgagctctagccactaggctacttgac |
39169608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 43403326 - 43403417
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||| |||||||||| |||||||| ||||| | ||||||||||| ||||| |||||||||| | | ||||||| ||||||||| |
|
|
| T |
43403326 |
atattatatgtaggggctggagttcgaaccttggacatcccacttctccacaattaaattgtgtgagctctagctactagactacttgacaa |
43403417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 89
Target Start/End: Original strand, 257576 - 257662
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| || ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
257576 |
ttatatgcaggggccgaggttcgaaccccggacattccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
257662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 89
Target Start/End: Complemental strand, 658344 - 658258
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| || ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
658344 |
ttatatgcaggggccgaggttcgaaccccggacattccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
658258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 89
Target Start/End: Complemental strand, 844080 - 843994
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| || ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
844080 |
ttatatgcaggggccgaggttcgaaccccggacattccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
843994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 89
Target Start/End: Complemental strand, 5326203 - 5326117
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||| ||| || |||||||||||||||||| ||||||||| | ||||| ||||||| || | ||||||||| ||||||| |
|
|
| T |
5326203 |
ttatatgcagaggccggtgttcgaaccccggacactccacttctccataattaaattgtgtgaactctagccactagactacttgac |
5326117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 92
Target Start/End: Original strand, 11127958 - 11128028
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaat |
92 |
Q |
| |
|
|||||||||||||||||| |||| |||||| ||||| |||||||||| | ||||||| | |||||||||| |
|
|
| T |
11127958 |
ttcgaaccccggacactccacttttccacaattaaattgtgtgagctctagccactaggctacttgacaat |
11128028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 26192752 - 26192662
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||| || || |||||||||||||||| | ||||||||| ||| |||||||||| || | ||||||||| ||| ||||| |
|
|
| T |
26192752 |
atattatatgcagaggtcggggttcgaaccccggacaccccacttctccatattaaaatgtgtgaactctagccactagactactagacaa |
26192662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 26567284 - 26567226
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
|||||||||||||| | || |||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
26567284 |
atattatatgcaggagtcgggattcgaaccccggacactcaatttctccacaattaaat |
26567226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 32191912 - 32191823
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||| |||| ||||| |||| |||||||||| ||||| | ||||||||||| |||| | ||| |||| || ||||||||| ||||||||| |
|
|
| T |
32191912 |
atattttatgtaggggttggagttcgaaccccagacaccccacttctccaca-ttaattatgtaagctacagccactagactacttgacaa |
32191823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 65
Target Start/End: Original strand, 38283164 - 38283222
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtga |
65 |
Q |
| |
|
||||||||||| || |||||||||| ||||| | |||||||||||||||| ||||||| |
|
|
| T |
38283164 |
tatgcaggggccggggttcgaaccccagacaccccacttctccacatttaattgtgtga |
38283222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 38620377 - 38620319
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
|||||||||||||| || || ||||||||||| |||||| ||||||||||| |||||| |
|
|
| T |
38620377 |
atattatatgcaggagccgggattcgaaccccgaacactccacttctccacaattaaat |
38620319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 68
Target Start/End: Complemental strand, 44340359 - 44340313
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
44340359 |
ttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
44340313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 11231460 - 11231521
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| || |||||||||||||||| | ||||||| ||| |||| |||||||||| |
|
|
| T |
11231460 |
tatgcaggggccggggttcgaaccccggacaccccacttctcgacaattaattgtgtgagct |
11231521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 27077133 - 27077044
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||| || |||||| ||||||||| | ||||||||||| ||||| |||||||||| ||||| ||| | ||||||| |
|
|
| T |
27077133 |
atattatatgcaggggtcggggttcgaatcccggacaccccacttctccacaattaaattgtgtgagctcgaaccattaggctacttgac |
27077044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 28420460 - 28420371
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||| || || || |||||||||||||||||| |||||||||| ||| || |||||||||| | ||||||| | ||||||| |
|
|
| T |
28420460 |
atattatatgctggagccggggttcgaaccccggacactccacttctccacgattaaattgtgtgagctctagccactaggctacttgac |
28420371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 30300367 - 30300440
Alignment:
| Q |
5 |
tatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccact |
77 |
Q |
| |
|
||||||||||||| || ||||||||||||| || | ||||||||| |||| ||||||||||||| ||| |||| |
|
|
| T |
30300367 |
tatatgcaggggccggggttcgaaccccggaaaccctacttctccatatttaaaatgtgtgagctccaaacact |
30300440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 34761001 - 34761058
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa |
58 |
Q |
| |
|
||||||||||||||| | ||| |||||||||||||||| | ||||| ||| ||||||| |
|
|
| T |
34761001 |
atattatatgcagggaccggagttcgaaccccggacaccccacttcaccatatttaaa |
34761058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 39362299 - 39362352
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatt |
54 |
Q |
| |
|
||||||||||||| || |||| |||||||||| ||||| | ||||||||||||| |
|
|
| T |
39362299 |
atattatatgcagaggttggagttcgaaccccagacaccccacttctccacatt |
39362352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 43656070 - 43656159
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||| ||||| || |||||||| |||||| || |||||||||| |||||| |||||||||| | ||||||||| ||||||| |
|
|
| T |
43656070 |
atattatatgtaggggtcggggttcgaacctcggacattccacttctccacaatttaattgtgtgagctctagccactagactacttgac |
43656159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 23 - 68
Target Start/End: Original strand, 43846991 - 43847036
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||| |||||| | |||||||||||||||| |||||||||| |
|
|
| T |
43846991 |
ttcgaaccctggacaccccacttctccacatttaattgtgtgagct |
43847036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 7763975 - 7763907
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||| || || |||| |||||||| | ||||||||||| ||||| |||||||||| |
|
|
| T |
7763975 |
atattatatgcaggggccgggatttgaactccggacaccccacttctccacaattaaattgtgtgagct |
7763907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 8953905 - 8953838
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| | || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
8953905 |
atattatatgcaggagtcggggttcgaaccccggacactc-acttctccacaattaaattgtgtgagct |
8953838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 79
Target Start/End: Complemental strand, 15856516 - 15856464
Alignment:
| Q |
27 |
aaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||| ||||||| | |||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
15856516 |
aacctcggacaccccacttctccacatttaattgtgtgagctctaaccactag |
15856464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 38
Target Start/End: Complemental strand, 17987512 - 17987476
Alignment:
| Q |
2 |
tattatatgcaggggctggatttcgaaccccggacac |
38 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
17987512 |
tattatatgcaggggccggagttcgaaccccggacac |
17987476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 26823726 - 26823782
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||| || ||||||| |
|
|
| T |
26823726 |
ttcgaaccccggacaccacccttctccacatttatatgtgtgagctccagccactag |
26823782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 32719643 - 32719556
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttga |
88 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||| |||| |||||| ||||| |||||||||| ||||||||| | |||||| |
|
|
| T |
32719643 |
atattatatgcagggt-tggggttcgaatcccggacactccacttttccacaattaaattgtgtgagctctaaccactaggctacttga |
32719556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 67
Target Start/End: Complemental strand, 40322896 - 40322832
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagc |
67 |
Q |
| |
|
||||||| | |||| ||| ||||||||||| |||||| ||||||||||| ||||| ||||||||| |
|
|
| T |
40322896 |
ttatatgtaagggccggagttcgaaccccgaacactccacttctccacaattaaattgtgtgagc |
40322832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 41865118 - 41865030
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||| | |||||||||| ||||||| | || ||||||||||| |||||||| | | ||||||||| ||||||| |
|
|
| T |
41865118 |
atattatatgcaggggtcagggttcgaaccccagacactccatttttccacatttaattgtgtgagttatagccactagactacttgac |
41865030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 51; Significance: 2e-20; HSPs: 110)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 12891591 - 12891681
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||| |||||| || |||||||||||||||| | ||||||||||||||| ||||||||||| ||||||||||| ||||||||| |
|
|
| T |
12891591 |
atattatatgtaggggccggggttcgaaccccggacaccccacttctccacatttatatgtgtgagctataaccactagactacttgacaa |
12891681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 6526084 - 6526165
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagac |
81 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||| ||||||||||| ||||| |||||||||| | ||||||||| |
|
|
| T |
6526084 |
atattatatgcaggggctggagttcgaaccccggatactccacttctccacaattaaattgtgtgagctctagccactagac |
6526165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 4 - 91
Target Start/End: Complemental strand, 41319484 - 41319396
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
41319484 |
ttatatgcaggggtcggagttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactagactacttgacaa |
41319396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 16386777 - 16386686
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||| |||| ||||||||||| ||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
16386777 |
atattatatgcaggagctggggttcgaaccccggatactccacttctccacaattaaattgtgtgagctctagccactagactacttgacaa |
16386686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 36124433 - 36124524
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||| || |||||| ||||||||||| |||||||||| |||||| |||||||||| ||||||||||| ||||||||| |
|
|
| T |
36124433 |
atattatatgcaggggtcggggttcgaatcccggacactccacttctccacaatttaactgtgtgagctctaaccactagactacttgacaa |
36124524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 36716894 - 36716827
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||||||| | || || ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36716894 |
atattatatgcagggaccggggtttgaaccccggacactcaacttctccacatttatatgtgtgagct |
36716827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 11188718 - 11188629
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||||||| ||| |||||| |||||||||||||||||| |||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
11188718 |
atattatatgcaggggctggggttcaaaccccagacactcaacttctccacaatttaattgtgtgagctctagccactaggctacttgac |
11188629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 26 - 91
Target Start/End: Complemental strand, 30801012 - 30800947
Alignment:
| Q |
26 |
gaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||| | ||||||||||| ||||||||| |
|
|
| T |
30801012 |
gaaccccggacactcaacttctccacatttaattctgtgagttctaaccactagactacttgacaa |
30800947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 39886248 - 39886159
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||| ||| ||||| |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||||| ||||||| |
|
|
| T |
39886248 |
atattatatgtaggagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactagactacttgac |
39886159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 23 - 91
Target Start/End: Original strand, 4068038 - 4068106
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||| |||||||||| ||||||||| | ||||||||| |
|
|
| T |
4068038 |
ttcgaaccccggacaccccacttctccacatttaattgtgtgagctccaaccactacgctacttgacaa |
4068106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 6518812 - 6518744
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
6518812 |
atattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
6518744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 4 - 91
Target Start/End: Original strand, 42916426 - 42916514
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || |||||||||||||||| | ||||||||||| ||||| ||||||||||| | |||||| || ||||||||| |
|
|
| T |
42916426 |
ttatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctttagccactaaactacttgacaa |
42916514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 9835067 - 9835158
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
9835067 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
9835158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 17545208 - 17545117
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctcca-catttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||| ||||||||| |||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
17545208 |
atattatatgcaggggccggggttcgaaccccggacactccacttctccataatttaattgtgtgagctctagccactaggctacttgacaa |
17545117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 39234775 - 39234704
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaa |
72 |
Q |
| |
|
||||| |||||||||| || |||||||||||||||| | |||||||||| |||||||||||||||||||| |
|
|
| T |
39234775 |
atattttatgcaggggtcgggattcgaaccccggacaccccacttctccacgtttaaatgtgtgagcttcaa |
39234704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 43580912 - 43581003
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || |||||| ||||||||||| ||||||||||| ||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
43580912 |
atattatatgcaggagccggggttcgaatcccggacactccacttctccacaattaaattgtgtgagctctagccactagactacttgacaa |
43581003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 26 - 68
Target Start/End: Original strand, 10364360 - 10364402
Alignment:
| Q |
26 |
gaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10364360 |
gaaccccggacactccacttctccacatttaaatgtgtgagct |
10364402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 23 - 89
Target Start/End: Original strand, 38696746 - 38696812
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||| |||||||| |||||| |||||||||||||||||||| | ||||||||| ||||||| |
|
|
| T |
38696746 |
ttcgaaccctggacactccacttcttcacatttaaatgtgtgagctctatccactagactacttgac |
38696812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 8968783 - 8968872
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
8968783 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
8968872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 11897282 - 11897371
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| | || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||||| ||||||| |
|
|
| T |
11897282 |
atattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactagactacttgac |
11897371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 12463790 - 12463879
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
12463790 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
12463879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 15241186 - 15241110
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccacta |
78 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| | ||||| |||||||||||| ||||||||||||| |||||||| |
|
|
| T |
15241186 |
atattatatgcatgggctggagttcgaaccccaaaaactca-cttctccacattaaaatgtgtgagctctaaccacta |
15241110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 17891892 - 17891816
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt--aaatgtgtgagcttcaaccacta |
78 |
Q |
| |
|
|||||||||||||| || |||||||||||||||| | |||||||||||||| ||||||||||||| || |||||| |
|
|
| T |
17891892 |
ttatatgcaggggccggggttcgaaccccggacaccccacttctccacattttaaaatgtgtgagctccagccacta |
17891816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 68
Target Start/End: Original strand, 18638635 - 18638700
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
18638635 |
ttatatgcaggggccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
18638700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 25400403 - 25400314
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
25400403 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
25400314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 32423599 - 32423688
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||||||| ||| |||||| ||||||| |||||||||| |||||| |||||||| | | ||||||||| ||||||| |
|
|
| T |
32423599 |
atattatatgcaggggctggggttcaaaccccagacactccacttctccacaatttaattgtgtgagttctagccactagactacttgac |
32423688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 88
Target Start/End: Complemental strand, 34389645 - 34389561
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttga |
88 |
Q |
| |
|
|||||||||||||| || || ||||||||||| |||||||||||||||| ||||| |||||||||| | ||||||||| |||||| |
|
|
| T |
34389645 |
ttatatgcaggggccgggtt-cgaaccccggatactcaacttctccacaattaaattgtgtgagctcaagccactagactacttga |
34389561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 91
Target Start/End: Complemental strand, 39800060 - 39799975
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||| || ||||||||| ||||| | ||||||||||||||||| ||||||||||||| ||||||||| | ||||||| |
|
|
| T |
39800060 |
tatgcaggggcaggggctcgaacccctgacaccccacttctccacatttaaaatgtgtgagcttcagccactagactatttgacaa |
39799975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 41179839 - 41179750
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||| ||||||||||| ||||||||||||||||| |||||||||| | |||||| || ||||||| |
|
|
| T |
41179839 |
atattatatgcaggagccggggttcgaatcccggacactccacttctccacatttaaattgtgtgagctctagccactaaactacttgac |
41179750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 42525434 - 42525515
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagac |
81 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||||| |
|
|
| T |
42525434 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactagac |
42525515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 4 - 79
Target Start/End: Original strand, 3740991 - 3741067
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||||||||| || |||||||||||||||| | |||||||||||||| ||||||||||||| || ||||||| |
|
|
| T |
3740991 |
ttatatgcaggggtcggggttcgaaccccggacaccccacttctccacatttaaaatgtgtgagctccagccactag |
3741067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 4417721 - 4417653
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
4417721 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
4417653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 4 - 79
Target Start/End: Complemental strand, 4418375 - 4418299
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||| | |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
4418375 |
ttatatgcaggggctggggttcgaacctcggacacctcatttctccacatttaaaatgtgtgagctccaaccactag |
4418299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 5966863 - 5966950
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| |||||| |||||| | | ||||||||| ||||||| |
|
|
| T |
5966863 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaat-tgtgagttctagccactagactacttgac |
5966950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 4 - 79
Target Start/End: Complemental strand, 11146562 - 11146486
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccaca-tttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||| ||||| |||| |||||||||||||||||| ||||||||||| || || |||||||||| ||||||||| |
|
|
| T |
11146562 |
ttatatgtaggggttggagttcgaaccccggacactccacttctccacagttcaattgtgtgagctctaaccactag |
11146486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 11774495 - 11774427
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
11774495 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
11774427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 21918086 - 21918154
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| ||||| ||||||||| |||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
21918086 |
atattatatgcaggagctggggttcgaaccctggacactccacttctccacaattaaattgtgtgagct |
21918154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 4 - 79
Target Start/End: Complemental strand, 23937966 - 23937890
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||| || |||||||||||||||| | ||| |||||||||| ||||||||||||| || ||||||| |
|
|
| T |
23937966 |
ttatatgcaggggccggggttcgaaccccggacaccccactcctccacatttaaaatgtgtgagctacagccactag |
23937890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 32505722 - 32505790
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
32505722 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
32505790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 8241084 - 8241163
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||| ||| || |||||||||||||||| | |||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
8241084 |
atattatatgcaagggtcggggttcgaaccccggacaccccacttctccacatttaaaatgtgtgagctctaaccactag |
8241163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 8478929 - 8478838
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||| |||||| ||| |||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
8478929 |
atattatatgcaggggctgtggttcgaaccccatacactccacttcttcacaatttaattgtgtgagctctagccactagactacttgacaa |
8478838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 15241430 - 15241521
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||| || |||||||| ||||||| | ||||||||||| ||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
15241430 |
atattatatgcaggggtcggggttcgaacctcggacaccccacttctccacaattaaattgtgtgagctctagccactagactacttgacaa |
15241521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 35515546 - 35515637
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || ||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
35515546 |
atattatatgcaggagccggggttcgaaccccggacacttcacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
35515637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 9125697 - 9125786
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||| | || || |||||||||||||| ||||||||||||||| ||||||||||| | ||||||| | ||||||||| |
|
|
| T |
9125697 |
atattatatgcagggccggggtt-cgaaccccggacacctcacttctccacatttatatgtgtgagctctagccactaggctacttgacaa |
9125786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 13621982 - 13621924
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| | ||||||||||| |||||| |
|
|
| T |
13621982 |
atattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaat |
13621924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 13876357 - 13876279
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccacta |
78 |
Q |
| |
|
||||||||||||| ||| || |||||||||||||||||| | |||||||| |||||| |||||||||| |||||||| |
|
|
| T |
13876357 |
atattatatgcagcggccggggttcgaaccccggacactccatttctccacaatttaactgtgtgagctctaaccacta |
13876279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 14641145 - 14641087
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
14641145 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaat |
14641087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 7 - 77
Target Start/End: Original strand, 24456229 - 24456298
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccact |
77 |
Q |
| |
|
|||||||||| ||| |||||||||||||||| || |||||||||| ||||||||||||||| || ||||| |
|
|
| T |
24456229 |
tatgcaggggtcggagttcgaaccccggacaccca-cttctccacagttaaatgtgtgagctccagccact |
24456298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 35112998 - 35112940
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
|||||||||||||||| ||| ||||||| |||||||||| ||||||||||| |||||| |
|
|
| T |
35112998 |
atattatatgcaggggttggggttcgaactccggacactctacttctccacaattaaat |
35112940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 40276478 - 40276388
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| | | ||||||||||| |||| |||||||| | | |||||||| ||||||||| |
|
|
| T |
40276478 |
atattatatgcaggggctgagattcgaaccccggacgccccacttctccacaattaattgtgtgagttctagccactagaatacttgacaa |
40276388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 4745912 - 4745823
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||| ||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
4745912 |
atattatatgaaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
4745823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 79
Target Start/End: Original strand, 7443379 - 7443452
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacattta-aatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||||||| || ||||||||| ||||| | ||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
7443379 |
tatgcaggggcaggggttcgaacccttgacaccccacttctccacatttataatgtgtgagctccaaccactag |
7443452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 10241759 - 10241848
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctcca-catttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||| ||| ||| |||||| ||||||| ||||||||| |||||| ||||||||||| | ||| ||||| ||||||| |
|
|
| T |
10241759 |
atattatatgcaggggttggggttcaaaccccagacactccacttctccagaatttaattgtgtgagctttagccattagactacttgac |
10241848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 4 - 88
Target Start/End: Complemental strand, 11786093 - 11786008
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttga |
88 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||| ||||||||||| ||||| |||||||||| | ||||||||| |||||| |
|
|
| T |
11786093 |
ttatatgcaggggctgaggttcgaaccccacacactccacttctccacaattaaattgtgtgagctctagccactagactacttga |
11786008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 13958416 - 13958497
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctcca-catttaaatgtgtgagcttcaaccactagac |
81 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||| ||||||||| |||||| |||||||||| | ||||||||| |
|
|
| T |
13958416 |
atattatatgcaggggacggggttcgaaccccggacactccacttctccataatttaattgtgtgagctctagccactagac |
13958497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 4 - 68
Target Start/End: Original strand, 16280283 - 16280348
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||| ||||| ||| |||||||||||||||||| ||| ||||||||||||| |||||||||| |
|
|
| T |
16280283 |
ttatatgtaggggttggggttcgaaccccggacactccactcctccacatttaaattgtgtgagct |
16280348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 17064894 - 17064829
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgag |
66 |
Q |
| |
|
||||||||||||||||| | || ||||||||||||| | |||||||||||||||| |||||||| |
|
|
| T |
17064894 |
atattatatgcaggggccgacgtttgaaccccggacaccccacttctccacatttaattgtgtgag |
17064829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 81
Target Start/End: Original strand, 19985538 - 19985615
Alignment:
| Q |
5 |
tatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagac |
81 |
Q |
| |
|
||||||||||| ||| ||||||| |||||||||||||||||||||| ||||| |||||||||| | ||||||||| |
|
|
| T |
19985538 |
tatatgcagggatcggagttcgaactccggacactcaacttctccacaattaaattgtgtgagctatatccactagac |
19985615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 4 - 68
Target Start/End: Original strand, 24033114 - 24033179
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || |||||||||||||||| | ||||||||||| ||||| |||||||||| |
|
|
| T |
24033114 |
ttatatgcaggggccggggttcgaaccccggacacgccacttctccacaattaaattgtgtgagct |
24033179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 79
Target Start/End: Complemental strand, 3821454 - 3821378
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||| || |||||| |||||| || | |||||||||||||| ||||||||||||| || ||||||| |
|
|
| T |
3821454 |
ttatatgcaggggccggggttcgaatcccggaaaccccacttctccacatttaaaatgtgtgagctccagccactag |
3821378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 4238344 - 4238276
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggac-actcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||| || |||||||||||||| | | |||||||||||||||| |||||||||| |
|
|
| T |
4238344 |
atattatatgcaggggccggggttcgaaccccggacgcccccacttctccacatttaattgtgtgagct |
4238276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 5900326 - 5900393
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||| || || ||||||||||||| || |||||||||| |||||| |||||||||| |
|
|
| T |
5900326 |
atattatatgcaggggccgggtt-cgaaccccggacattccacttctccacaatttaattgtgtgagct |
5900393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 18050213 - 18050281
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagct |
68 |
Q |
| |
|
|||||| ||||||||| || |||||||||||||||||| |||||||||| |||||| |||||||||| |
|
|
| T |
18050213 |
atattaaatgcaggggtcggggttcgaaccccggacactccacttctccacaatttaattgtgtgagct |
18050281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 23155949 - 23156005
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||| ||| |||| |||||||||||||||| |||||||||||| ||| |||||| |
|
|
| T |
23155949 |
ttcgaactccgaacacccaacttctccacattttaatgtgtgagctccaatcactag |
23156005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 24477881 - 24477937
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||| ||||||| | |||||||||||||||| |||||||||| || ||||||| |
|
|
| T |
24477881 |
ttcgaacctcggacaccccacttctccacatttaattgtgtgagctccagccactag |
24477937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 23 - 88
Target Start/End: Complemental strand, 25460795 - 25460728
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacattt--aaatgtgtgagcttcaaccactagacgacttga |
88 |
Q |
| |
|
||||||||||| |||| | |||||||||||||| ||||||||||||| ||||||||||| |||||| |
|
|
| T |
25460795 |
ttcgaaccccgaacaccccacttctccacatttaaaaatgtgtgagctctaaccactagactacttga |
25460728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 79
Target Start/End: Complemental strand, 28871357 - 28871281
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||||||||| || |||||| ||||||||||| |||||||| ||||| ||||||||||| | |||||||||| |
|
|
| T |
28871357 |
ttatatgcaggggtcggggttcgaatcccggacactccacttctccgcatttaaaatgtgtgagttccaaccactag |
28871281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 32706356 - 32706424
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||| ||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
32706356 |
atattatatggaggagccgggattcgaaccccggacactccacttctccacaattaaattgtgtgagct |
32706424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 23 - 78
Target Start/End: Original strand, 33909061 - 33909117
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccacta |
78 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||| |||||| || |||||| |
|
|
| T |
33909061 |
ttcgaaccccggacacccaacttctccacatttaaaatgtatgagctccagccacta |
33909117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 36888431 - 36888363
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| | || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
36888431 |
atattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
36888363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 41156362 - 41156430
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat-gtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || ||||||| |||||||||| ||||||||||| |||||| ||||||||| |
|
|
| T |
41156362 |
atattatatgcaggagccggggttcgaactccggacactccacttctccacaattaaatcgtgtgagct |
41156430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 42320351 - 42320419
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| | ||| ||||||||||| |||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
42320351 |
atattatatgcaggagtcggagttcgaaccccgaacactccacttctccacaattaaattgtgtgagct |
42320419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 3 - 89
Target Start/End: Complemental strand, 2301605 - 2301518
Alignment:
| Q |
3 |
attatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||| || || |||||||||||||||||| | ||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
2301605 |
attatatgcaggagccggggttcgaaccccggacactccatttctccacaattaaattgtgtgagctctagccactaggctacttgac |
2301518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 91
Target Start/End: Complemental strand, 6734770 - 6734684
Alignment:
| Q |
5 |
tatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||| |||||| || ||||||| |||| |||| | ||||||||||||||||| |||||||||| || ||||||||| | ||||||| |
|
|
| T |
6734770 |
tatatgtaggggccgggtttcgaatcccg-acaccccacttctccacatttaaaatgtgtgagctccagccactagactaattgacaa |
6734684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 10404161 - 10404252
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| | || |||||||||||||||||| | ||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
10404161 |
atattatatgcaggagtcggggttcgaaccccggacactccatttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
10404252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 23 - 89
Target Start/End: Original strand, 11795549 - 11795616
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
11795549 |
ttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
11795616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 86
Target Start/End: Original strand, 12474022 - 12474100
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgactt |
86 |
Q |
| |
|
||||||||||||| | ||||||| ||| |||| | ||||||||||| |||| |||||||||| ||||||||||| |||| |
|
|
| T |
12474022 |
tatgcaggggctgaagttcgaactccgaacaccccacttctccaca-ttaattgtgtgagctctaaccactagactactt |
12474100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 35241430 - 35241520
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||| || |||||| ||| ||||||| |||||||||| |||||| |||||||| || | ||||||||| ||||||||| |
|
|
| T |
35241430 |
atattatatgcaggggtcggggttcgaa-ccctgacactccacttctccacaatttaattgtgtgagttttagccactagactacttgacaa |
35241520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 2 - 45
Target Start/End: Complemental strand, 42455457 - 42455414
Alignment:
| Q |
2 |
tattatatgcaggggctggatttcgaaccccggacactcaactt |
45 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||| |||| |
|
|
| T |
42455457 |
tattatatgcaggggccggagttcgaaccccggacactccactt |
42455414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 91
Target Start/End: Complemental strand, 885153 - 885103
Alignment:
| Q |
42 |
acttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||| ||||||| |||||||||| |||||||||||| ||||||||| |
|
|
| T |
885153 |
acttctccatatttaaaatgtgtgagctccaaccactagactacttgacaa |
885103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 32 - 78
Target Start/End: Original strand, 1382197 - 1382243
Alignment:
| Q |
32 |
cggacactcaacttctccacatttaaatgtgtgagcttcaaccacta |
78 |
Q |
| |
|
||||||||| |||| ||||||||||| ||||||||||| |||||||| |
|
|
| T |
1382197 |
cggacactccacttttccacatttaattgtgtgagctttaaccacta |
1382243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 2328626 - 2328684
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
|||||||||||||| || || |||||||||| ||||||| ||||||||||| |||||| |
|
|
| T |
2328626 |
atattatatgcaggagccggggttcgaaccccagacactccacttctccacaattaaat |
2328684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 77
Target Start/End: Original strand, 7171768 - 7171838
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccact |
77 |
Q |
| |
|
||||||||||| || |||||||||| ||||| | ||||||||||| |||| |||||||||| || ||||| |
|
|
| T |
7171768 |
tatgcaggggccggggttcgaaccccagacaccccacttctccacaattaattgtgtgagctccagccact |
7171838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 81
Target Start/End: Original strand, 8571849 - 8571907
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagac |
81 |
Q |
| |
|
||||||||||| |||| | |||||||||||||||| |||||||||| | ||||||||| |
|
|
| T |
8571849 |
ttcgaaccccgaacaccctacttctccacatttaattgtgtgagctctagccactagac |
8571907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 65
Target Start/End: Complemental strand, 14804996 - 14804954
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtga |
65 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||| ||||||| |
|
|
| T |
14804996 |
ttcgaaccccggacaccccacttctccacatttaattgtgtga |
14804954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 33 - 91
Target Start/End: Original strand, 15210856 - 15210914
Alignment:
| Q |
33 |
ggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||| | |||||||||||||||||||||||| || |||||||||| ||||||||| |
|
|
| T |
15210856 |
ggacaccccacttctccacatttaaatgtgtgaactctgaccactagactacttgacaa |
15210914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 88
Target Start/End: Original strand, 16789126 - 16789192
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttga |
88 |
Q |
| |
|
|||||||||||||||| | ||||||||||| ||||| |||||||||| | ||||||||| |||||| |
|
|
| T |
16789126 |
ttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactagactacttga |
16789192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 68
Target Start/End: Original strand, 27798677 - 27798723
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
27798677 |
ttcgaaccccggacactctacttctccacaattaaattgtgtgagct |
27798723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 81
Target Start/End: Complemental strand, 33018540 - 33018482
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagac |
81 |
Q |
| |
|
||||||| ||||||| | ||||||||||||||| ||||||||||| || ||||||||| |
|
|
| T |
33018540 |
ttcgaacttcggacaccccacttctccacatttatatgtgtgagctccagccactagac |
33018482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 69
Target Start/End: Complemental strand, 41477391 - 41477325
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagctt |
69 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||| |||| || ||| ||||| ||||||||||| |
|
|
| T |
41477391 |
ttatatgcaggggctggggttcgaaccccgaacactccacttttcgacaattaaattgtgtgagctt |
41477325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 66
Target Start/End: Original strand, 3198365 - 3198426
Alignment:
| Q |
5 |
tatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgag |
66 |
Q |
| |
|
|||||||||||| || |||||||||||||||| | |||||||||||||||| | |||||| |
|
|
| T |
3198365 |
tatatgcaggggttgaggttcgaaccccggacaccctacttctccacatttaattatgtgag |
3198426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 68
Target Start/End: Complemental strand, 6735822 - 6735757
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||| || ||||||||||| |||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
6735822 |
ttatatgcaggggtcggggttcgaaccccgaacactccacttctccacaattaaattgtgtgagct |
6735757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 7143448 - 7143513
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgag |
66 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||| |||||| |||| |||| |||||||| |
|
|
| T |
7143448 |
atattatatgcacaggctggagttcgaaccccggacacctcacttcttcacaattaattgtgtgag |
7143513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 23 - 91
Target Start/End: Original strand, 16891402 - 16891471
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||| |||| |||||| ||||||||||| ||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
16891402 |
ttcgaatcccgaacactccacttctccacaattaaattgtgtgagctctagccactagactacttgacaa |
16891471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 23 - 91
Target Start/End: Complemental strand, 19480702 - 19480633
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||| | ||||||||| | || ||||| ||||||||| |
|
|
| T |
19480702 |
ttcgaaccccggatactcaacttctccacaattaaattatgtgagctttagtcattagactacttgacaa |
19480633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 68
Target Start/End: Complemental strand, 19891459 - 19891394
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||| ||| |||||| |||||| |||| ||||||||||| ||||| |||||||||| |
|
|
| T |
19891459 |
ttatatgcaggggttggggttcgaatcccggatactccacttctccacaattaaattgtgtgagct |
19891394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 23 - 68
Target Start/End: Complemental strand, 20145578 - 20145533
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||| ||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
20145578 |
ttcgaacctcggacaccccacttctccacatttaattgtgtgagct |
20145533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 68
Target Start/End: Complemental strand, 25729473 - 25729408
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||| || |||||||||| ||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
25729473 |
ttatatgcaggggtcggggttcgaaccccagacactccacttctccacaattaaattgtgtgagct |
25729408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 27765291 - 27765380
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| | || ||||||||||| |||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
27765291 |
atattatatgcaggaggcggggttcgaaccccgcacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
27765380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 36735905 - 36735997
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac--atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||| ||||| ||| ||||||||| ||||||| |||||||||| |||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
36735905 |
atattatatgtaggggtcggagttcgaaccctagacactccacttctccacaaatttaattgtgtgagctctagccactaggctacttgacaa |
36735997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 68
Target Start/End: Original strand, 41930142 - 41930207
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||| | ||||||| ||| ||||| |||||||||| |
|
|
| T |
41930142 |
ttatatgcaggggctggggttcgaaccccagacaccccacttctctacaattaaattgtgtgagct |
41930207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 988749 - 988816
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| ||||| |||||||||| |||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
988749 |
atattatatgcaggagctggggttcgaacccc-aacactccacttctccacaattaaattgtgtgagct |
988816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 1743161 - 1743228
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || || |||||||||||||||| ||||||| ||| ||||| |||||||||| |
|
|
| T |
1743161 |
atattatatgcaggagccgggtt-cgaaccccggacactccacttctctacaattaaattgtgtgagct |
1743228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 6558835 - 6558903
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||| || ||||||| |||||||| | ||||||||||| ||||| |||||||||| |
|
|
| T |
6558835 |
atattatatgcaggggtcggggttcgaactccggacaccctacttctccacaattaaattgtgtgagct |
6558903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 7545434 - 7545367
Alignment:
| Q |
1 |
atattatatgcagggg-ctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagc |
67 |
Q |
| |
|
|||||||||||||||| | ||||| |||| ||||||||| | |||||||||||||| |||||||||||| |
|
|
| T |
7545434 |
atattatatgcaggggtcaggatt-cgaatcccggacaccccacttctccacatttaaaatgtgtgagc |
7545367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 52
Target Start/End: Complemental strand, 17175084 - 17175036
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccaca |
52 |
Q |
| |
|
|||||||||||||| || |||||||| ||||||||| ||||||||||| |
|
|
| T |
17175084 |
ttatatgcaggggccggggttcgaacctcggacactccacttctccaca |
17175036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 68
Target Start/End: Complemental strand, 20707819 - 20707755
Alignment:
| Q |
5 |
tatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
20707819 |
tatatgcaggggttggggttcgaaccccagacacttcacttctccacaattaaattgtgtgagct |
20707755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 38
Target Start/End: Complemental strand, 26169075 - 26169039
Alignment:
| Q |
2 |
tattatatgcaggggctggatttcgaaccccggacac |
38 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
26169075 |
tattatatgcaggggttggagttcgaaccccggacac |
26169039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 59
Target Start/End: Original strand, 29154898 - 29154934
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
29154898 |
ttcgaaccccggacactccacttctccacaattaaat |
29154934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 10 - 89
Target Start/End: Complemental strand, 33373028 - 33372949
Alignment:
| Q |
10 |
gcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||| |||| ||||||| ||| |||| || ||||||||||||| |||||||| |||| || ||||||||| ||||||| |
|
|
| T |
33373028 |
gcaggggttggagttcgaactccgaacaccca-cttctccacatttaaaatgtgtaagctccagccactagactacttgac |
33372949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 138)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 4 - 81
Target Start/End: Original strand, 28715727 - 28715805
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactagac |
81 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||| |||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
28715727 |
ttatatgcaggggccggggttcgaaccccggacactccacttctccacatttaaaatgtgtgagcttcagccactagac |
28715805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 21935511 - 21935602
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| | ||||||||||| ||||| ||||||||||| | ||||||||| ||||||||| |
|
|
| T |
21935511 |
atattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctttagccactagactacttgacaa |
21935602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 9761149 - 9761238
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||| ||||||||||| ||||| |||||||||| ||||||||||| ||||||| |
|
|
| T |
9761149 |
atattatatgcaggagctggggttcgaaccccggacacttcacttctccacaattaaattgtgtgagctctaaccactagactacttgac |
9761238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 47934108 - 47934019
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||| |||||||||| |||||| |||||||||| | ||||||||| ||||||| |
|
|
| T |
47934108 |
atattatatgcaggggccggggttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagccactagactacttgac |
47934019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 627018 - 626927
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||| | ||||| |||||||||||||||||| ||||||||||| ||||| |||||||||| ||||||||| | ||||||||| |
|
|
| T |
627018 |
atattatatgcaagagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactaggctacttgacaa |
626927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 48569212 - 48569121
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||| |||||||||| |||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
48569212 |
atattatatgcaggggctggggttcgaaccccagacactccacttctccacaatttaattgtgtgagctctagccactaggctacttgacaa |
48569121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 23 - 81
Target Start/End: Complemental strand, 38848134 - 38848076
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagac |
81 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38848134 |
ttcgaaccccggacaccccacttctccacatttaaatgtgtgagctctaaccactagac |
38848076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 55055950 - 55056040
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||| ||||||||||| | |||||||||||||||| | |||||||||||||||| |||||||||| ||||||||| | ||||||||| |
|
|
| T |
55055950 |
atattttatgcaggggccgaggttcgaaccccggacacgccacttctccacatttaattgtgtgagctccaaccactacgctacttgacaa |
55056040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 40486481 - 40486542
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| || |||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
40486481 |
tatgcaggggccggggttcgaaccccggacactccacttcttcacatttaaatgtgtgagct |
40486542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 4 - 79
Target Start/End: Original strand, 30305836 - 30305912
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||| ||||||||||||| || ||||||| |
|
|
| T |
30305836 |
ttatatgcaggggctggggttcgaaccccggacacctcacttctccacatttaaaatgtgtgagctccagccactag |
30305912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 4 - 79
Target Start/End: Complemental strand, 36099216 - 36099140
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||| || |||||||||||||||| | |||||||||||||| ||||||||||||| || ||||||| |
|
|
| T |
36099216 |
ttatatgcaggggccggggttcgaaccccggacaccccacttctccacatttaaaatgtgtgagctccagccactag |
36099140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 24 - 91
Target Start/End: Original strand, 41854190 - 41854258
Alignment:
| Q |
24 |
tcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||| |||||||||| || ||||||||| ||||||||| |
|
|
| T |
41854190 |
tcgaaccctggacactcaacttctccacaattaaattgtgtgagctccagccactagactacttgacaa |
41854258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 1458054 - 1457975
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| ||||||||| |
|
|
| T |
1458054 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactag |
1457975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 4590280 - 4590371
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||| ||||||||| |||||||||| ||||||| |||||||||| |||||| ||||||||||| | ||||||| | ||||||||| |
|
|
| T |
4590280 |
atattatatacaggggctgaggttcgaaccccagacactccacttctccacaatttaattgtgtgagctttagccactaggctacttgacaa |
4590371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 4958592 - 4958501
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| | || |||||||||||||||||| ||||||||||| ||||| | ||||||||| |||||||| || ||||||||| |
|
|
| T |
4958592 |
atattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattatgtgagctttaaccactaaactacttgacaa |
4958501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 5179918 - 5179828
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| ||||||||| || | |||||||| ||||||||| |
|
|
| T |
5179918 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagc-tctaacactagactacttgacaa |
5179828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 23 - 78
Target Start/End: Complemental strand, 9765037 - 9764982
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccacta |
78 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
9765037 |
ttcgaaccccggacaccctacttctccacatttaaatgtgtgagctccaactacta |
9764982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 12582064 - 12581973
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
12582064 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
12581973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 22230470 - 22230391
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||| ||| ||||| ||||||||||| ||||||||| |
|
|
| T |
22230470 |
atattatatgcaggagccggggttcgaaccccggacactccacttctcaacaattaaattgtgtgagctttaaccactag |
22230391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 23778861 - 23778770
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||| | ||||||||||| ||||| |||||||||| |||||||| || ||||||||| |
|
|
| T |
23778861 |
atattatatgcaggggttggggttcgaaccccagacaccccacttctccacaattaaattgtgtgagctctaaccactaaactacttgacaa |
23778770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 37868603 - 37868512
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||| ||||||||||| ||||| |||||||||| |||||||| || | ||||||| |
|
|
| T |
37868603 |
atattatatgcaggggctggagttcgaacctcggacacctcacttctccacaattaaattgtgtgagctctaaccactaaactatttgacaa |
37868512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 42218784 - 42218875
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||| | ||||||||| ||||||| |||||||||| |||||||||| |||||| ||||||||||| | ||||||| | ||||||||| |
|
|
| T |
42218784 |
atattatacgtaggggctggggttcgaactccggacactccacttctccacaatttaattgtgtgagctttagccactaggctacttgacaa |
42218875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 42395261 - 42395352
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||| |||||| || ||||||| |||||||| | ||||||||||| ||||| ||||||||||| | ||||||||| ||||||||| |
|
|
| T |
42395261 |
atattatatgtaggggccggggttcgaactccggacaccccacttctccacaattaaattgtgtgagctttagccactagactacttgacaa |
42395352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 45126166 - 45126257
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||| |||||||||| |||||| ||||||||||| | ||||||| | ||||||||| |
|
|
| T |
45126166 |
atattatatgcaggagctgaggttcgaaccccagacactccacttctccacaatttaattgtgtgagctttagccactaggctacttgacaa |
45126257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 45849081 - 45849172
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||| ||||||||||||||| ||||||||| |||||||| |||||||||| |||||| |||||||| | | ||||||| | ||||||||| |
|
|
| T |
45849081 |
atattttatgcaggggctggagttcgaaccctggacactccacttctccacaatttaattgtgtgagttctagccactaggctacttgacaa |
45849172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 46998404 - 46998313
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||| ||||| ||||||||| |
|
|
| T |
46998404 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccattagactacttgacaa |
46998313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 4 - 89
Target Start/End: Original strand, 18360530 - 18360616
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||| ||||||||||| ||||| |||||||| | ||||||| ||| ||||||| |
|
|
| T |
18360530 |
ttatatgcaggggccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagttctaaccactggactacttgac |
18360616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 25235833 - 25235767
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgag |
66 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||| |||||||||| |||||| |||||||| |
|
|
| T |
25235833 |
atattatatgcaggggctggggttcgaaccccagacactccacttctccacaatttaattgtgtgag |
25235767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 4 - 89
Target Start/End: Complemental strand, 36602399 - 36602313
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||| ||||||||||| ||||| |||||||| | ||||||| ||| ||||||| |
|
|
| T |
36602399 |
ttatatgcaggggccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagttctaaccactggactacttgac |
36602313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 91
Target Start/End: Original strand, 624520 - 624605
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||| || |||||||||| ||||| | |||||||||||||| ||||||||||||| |||||||| || ||||||||| |
|
|
| T |
624520 |
tatgcaggggcaggggttcgaacccctgacaccccacttctccacatttaaaatgtgtgagctctaaccactaaactacttgacaa |
624605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 5801989 - 5802078
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||||||| |||||||| | |||||| |||||||||| |||| | ||||||||||| |||||||| || ||||||| |
|
|
| T |
5801989 |
atattatatgcaggggctggggttcgaacctcacacactccacttctccacaattttattgtgtgagctttaaccactaaactacttgac |
5802078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 8965128 - 8965217
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| | ||||||| ||| ||||| |||||||||| ||||||||| | ||||||| |
|
|
| T |
8965128 |
atattatatgcaggggccggggttcgaaccccggacaccccacttctctacaattaaattgtgtgagctctaaccactaggctacttgac |
8965217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 23 - 91
Target Start/End: Complemental strand, 10417235 - 10417166
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
10417235 |
ttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactagactacttgacaa |
10417166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 68
Target Start/End: Complemental strand, 11294868 - 11294807
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| || |||||||||||||||| | |||||||||||||||||||| |||||| |
|
|
| T |
11294868 |
tatgcaggggccggggttcgaaccccggacaccccacttctccacatttaaatgtttgagct |
11294807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 26868383 - 26868471
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || || |||||||||||||||| ||||||||||| ||||| ||||||||||| | ||||||| | ||||||| |
|
|
| T |
26868383 |
atattatatgcaggagccgggtt-cgaaccccggacactccacttctccacaattaaattgtgtgagctttagccactaggctacttgac |
26868471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 43147420 - 43147331
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
43147420 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
43147331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 43596929 - 43597018
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
43596929 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
43597018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 46775066 - 46774977
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
46775066 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
46774977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 51890837 - 51890898
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| || |||||||||||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
51890837 |
tatgcaggggccggggttcgaaccccggacaccccacttctccacatttaattgtgtgagct |
51890898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 53634287 - 53634198
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||| |||| ||||| |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
53634287 |
atattatatacaggagctgggattcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
53634198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 55021588 - 55021677
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||||| ||||||| |
|
|
| T |
55021588 |
atattatatgcaggggtcggggttcgaaccccggacacttcacttctccacaattaaattgtgtgagctctagccactagactacttgac |
55021677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 2688130 - 2688218
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| |||| |||||| ||||||||| | | ||||||||||||||||||||||||| | ||||||| | ||||||| |
|
|
| T |
2688130 |
atattatatgcaggagctgtggttcgaatcccggacaccccatttctccacatttaaatgtgtgagctctagccactaggctacttgac |
2688218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 3764044 - 3763976
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||||||| |||||||||| || |||| |||||||||| |||||| |||||||||| |
|
|
| T |
3764044 |
atattatatgcaggggctggggttcgaaccccagatactccacttctccacaatttaattgtgtgagct |
3763976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 4 - 91
Target Start/End: Complemental strand, 5305043 - 5304955
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
5305043 |
ttatatgcaggggccgaggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
5304955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 12267552 - 12267640
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttga |
88 |
Q |
| |
|
|||||||||| ||||||| || ||| |||||||||||| | |||||||||| || ||| |||||||||| ||||||||||| |||||| |
|
|
| T |
12267552 |
atattatatgtaggggctagagttcaaaccccggacaccccacttctccacaatataattgtgtgagctctaaccactagactacttga |
12267640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 42231546 - 42231614
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
42231546 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
42231614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 4 - 91
Target Start/End: Original strand, 45741512 - 45741600
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||| || ||| |||||||||| ||||||| |||| |||||| ||||| ||||||| || ||||||||||| ||||||||| |
|
|
| T |
45741512 |
ttatatgcaggagccggagttcgaaccccagacactccacttatccacaattaaattgtgtgaactctaaccactagactacttgacaa |
45741600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 46105569 - 46105637
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
46105569 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
46105637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 49056809 - 49056877
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || ||| |||||||||||||||| | ||||||||||| ||||| |||||||||| |
|
|
| T |
49056809 |
atattatatgcaggagccggagttcgaaccccggacaccccacttctccacaattaaattgtgtgagct |
49056877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 55251387 - 55251319
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
55251387 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
55251319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 194713 - 194622
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||| |||| ||||| |||||| |||||||| | | |||||| || ||||||||| |
|
|
| T |
194713 |
atattatatgcaggggttggggttcgaaccccggacactccacttgtccacaatttaattgtgtgagttctagccactatactacttgacaa |
194622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 10402475 - 10402566
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
10402475 |
atattatatgcaggggtcggagttcgaaccccggacacctcacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
10402566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 4 - 59
Target Start/End: Complemental strand, 17617013 - 17616958
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
17617013 |
ttatatgcaggggccggggttcgaaccccggacactccacttctccacaattaaat |
17616958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 26919504 - 26919413
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| ||||| ||||||| |||||||||| |||||| |||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
26919504 |
atattatatgcaggagctggggttcgaactccggacactccacttcttcacaattaaattgtgtgagctctagccactaggctacttgacaa |
26919413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 29771335 - 29771244
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||| |||||||||| |||||| ||| |||||| | |||||| || ||||||||| |
|
|
| T |
29771335 |
atattatatgcaggggccggggttcgaaccccgggcactccacttctccacaatttaattgtttgagctctagccactaaactacttgacaa |
29771244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 30217633 - 30217712
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||||||| || |||||| ||| ||||||| | ||||||||| ||||| ||||||||||| | ||||||| |
|
|
| T |
30217633 |
atattatatgcaggggctagagttcgaatcccagacactccagttctccacaattaaattgtgtgagctttagccactag |
30217712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 47890729 - 47890808
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||| ||||||||||| ||||| |||||||||| ||||||||| |
|
|
| T |
47890729 |
atattatatgcaggggtcggggttcgaaccccagacactccacttctccacaattaaattgtgtgagctctaaccactag |
47890808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 49757320 - 49757229
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || ||||||||| |||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
49757320 |
atattatatgcaggagccggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
49757229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 52731475 - 52731384
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || ||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
52731475 |
atattatatgcaggagccggggttcgaaccccggacacttcacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
52731384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 637133 - 637191
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
637133 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaat |
637191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 4 - 89
Target Start/End: Original strand, 2222576 - 2222662
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || |||||||||||||||| | ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
2222576 |
ttatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
2222662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 23 - 81
Target Start/End: Original strand, 3784967 - 3785025
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagac |
81 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
3784967 |
ttcgaaccccgaacaccacacttctccacatttaaatgtgtgagctccagccactagac |
3785025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 3 - 68
Target Start/End: Complemental strand, 17709494 - 17709428
Alignment:
| Q |
3 |
attatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||| |||||| ||| |||||||||||||||||| ||||||| ||| ||||| |||||||||| |
|
|
| T |
17709494 |
attatatgtaggggccggagttcgaaccccggacactccacttctctacaattaaattgtgtgagct |
17709428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 20320475 - 20320541
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgag |
66 |
Q |
| |
|
||||||||||||||||| | | |||||||||||||||||| ||||| |||| |||||| |||||||| |
|
|
| T |
20320475 |
atattatatgcaggggccgaagttcgaaccccggacactccacttcaccacaatttaattgtgtgag |
20320541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 6 - 91
Target Start/End: Original strand, 28815650 - 28815736
Alignment:
| Q |
6 |
atatgcaggggctggatttcgaaccccggaca-ctcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||| || |||||||| | |||| | | ||||||||||||| ||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
28815650 |
atatgcaggggccgggattcgaacctcagacatccccacttctccacattaaaatgtgtgagctctaaccactagactacttgacaa |
28815736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 30 - 91
Target Start/End: Complemental strand, 35207158 - 35207096
Alignment:
| Q |
30 |
cccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||| ||||||||||| ||||| ||||||||||||| | ||||||| ||||||||| |
|
|
| T |
35207158 |
cccggacactctacttctccacaattaaattgtgtgagcttcagctactagactacttgacaa |
35207096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 4 - 89
Target Start/End: Complemental strand, 53376712 - 53376626
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat-gtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||| |||| || |||||||||||||||||| ||||||||||| |||||| ||||||||| | | ||||||| ||||||| |
|
|
| T |
53376712 |
ttatatgcaagggccggggttcgaaccccggacactccacttctccacaattaaatcgtgtgagctctagctactagactacttgac |
53376626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 2565112 - 2565177
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgag |
66 |
Q |
| |
|
|||||||||||||||| ||| |||||| ||||||||||| ||||||||| ||| |||||||||| |
|
|
| T |
2565112 |
atattatatgcaggggttgggattcgaatcccggacactccacttctccatattataatgtgtgag |
2565177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 3036091 - 3036002
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||| | ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
3036091 |
atattatatgcaggggccgaggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
3036002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 6371148 - 6371237
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| |||||| |||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
6371148 |
atattatatgcaggagccggggttcgaaccccggacactccacttcttcacaattaaattgtgtgagctctagccactaggctacttgac |
6371237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 23 - 75
Target Start/End: Complemental strand, 7513395 - 7513342
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaacca |
75 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||| ||||||| |||||| |
|
|
| T |
7513395 |
ttcgaaccccggacactccacttctccacatttaaaatgcgtgagctccaacca |
7513342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 4 - 68
Target Start/End: Complemental strand, 7686295 - 7686230
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || ||||||||| |||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
7686295 |
ttatatgcaggggccggggttcgaaccctggacactccacttctccacaattaaattgtgtgagct |
7686230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 12678541 - 12678598
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa |
58 |
Q |
| |
|
||||||||||||||||||||| |||||| ||| ||||| | |||| |||||||||||| |
|
|
| T |
12678541 |
atattatatgcaggggctggaattcgaaacccagacaccccacttatccacatttaaa |
12678598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 13578501 - 13578432
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagctt |
69 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||| | ||||||||||| ||||| ||||||||||| |
|
|
| T |
13578501 |
atattatatgcaggggtcggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctt |
13578432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 68
Target Start/End: Complemental strand, 23924902 - 23924841
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| || ||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
23924902 |
tatgcaggggccggggttcgaaccccggacacttcacttctccacatttatttgtgtgagct |
23924841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 30057256 - 30057345
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||| || ||| |||||||||||| | ||||||||||| ||||| |||||||||| ||||||||| | ||||||| |
|
|
| T |
30057256 |
atattatatgcaggggtcggggttcaaaccccggacaccccacttctccacaattaaattgtgtgagctctaaccactaggctacttgac |
30057345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 36132263 - 36132352
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| | || |||||||||||||||||| ||||||||||| ||||| |||||||| | ||||||||| | ||||||| |
|
|
| T |
36132263 |
atattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgaggtctaaccactaggctacttgac |
36132352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 23 - 91
Target Start/End: Complemental strand, 39696352 - 39696283
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||| |||||| ||||||||||| ||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
39696352 |
ttcgaaccccgaacactctacttctccacaattaaattgtgtgagctctagccactagactacttgacaa |
39696283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 49264566 - 49264627
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| | |||||||||||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
49264566 |
tatgcaggggccgaggttcgaaccccggacaccccacttctccacatttaattgtgtgagct |
49264627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 49901516 - 49901605
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| | |||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
49901516 |
atattatatgcaggggccggggttcgaaccccggacaccccgcttctccacaattaaattgtgtgagctctagccactaggctacttgac |
49901605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 50457750 - 50457661
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||| |||||||||| |||||| |||| ||||| | ||||||| | ||||||| |
|
|
| T |
50457750 |
atattatatgcaggggccagggttcgaaccccggacactccacttctccacaatttaattgtgcgagctgtagccactaggctacttgac |
50457661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 5165891 - 5165958
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||| || |||||||||| ||||||| |||||||||| |||||| |||||||||| |
|
|
| T |
5165891 |
atattatatgcaggggccggggttcgaacccc-gacactccacttctccacaatttaattgtgtgagct |
5165958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 71
Target Start/End: Complemental strand, 6170999 - 6170935
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttca |
71 |
Q |
| |
|
|||| ||||||||| |||||||| | ||||||| |||||||||||||||| |||||||| |||| |
|
|
| T |
6170999 |
tatgtaggggctggggttcgaacctcagacactctacttctccacatttaattgtgtgagtttca |
6170935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 11375925 - 11375857
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| |||||||||| ||| ||||||||||||| |
|
|
| T |
11375925 |
atattatatgcaggggccggggttcgaaccccggacacctcacttctccacaattaaaatgtgtgagct |
11375857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 29406413 - 29406469
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||| ||||||| | |||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
29406413 |
ttcgaactccggacaacccacttctccacatttaattgtgtgagctccaaccactag |
29406469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 31852649 - 31852581
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||| ||||| ||| |||||||||||||||||| | |||||||| |||||| |||||||||| |
|
|
| T |
31852649 |
atattatatgtaggggttggggttcgaaccccggacactccatttctccacaatttaattgtgtgagct |
31852581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 67
Target Start/End: Original strand, 34618319 - 34618383
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagc |
67 |
Q |
| |
|
||||||||||||| ||| || ||||||||||||||| ||||||||||| ||||| ||||||||| |
|
|
| T |
34618319 |
ttatatgcaggggttggggttggaaccccggacactccacttctccacaattaaattgtgtgagc |
34618383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 45112147 - 45112079
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||| | ||||| |||||||||| |
|
|
| T |
45112147 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccataattaaattgtgtgagct |
45112079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 46903365 - 46903432
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacattta-aatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||| ||| ||| ||||||||||||| | |||||||| |||||| |||||||||||| |
|
|
| T |
46903365 |
atattatatgcaggggttgggttt-gaaccccggacaccccacttctccgcatttataatgtgtgagct |
46903432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 50512394 - 50512462
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagctt |
69 |
Q |
| |
|
|||||||||||||||| || |||||||| | ||||| |||||||||||||||||||||||||||| |
|
|
| T |
50512394 |
atattatatgcaggggttgaggttcgaacctctgacaccttacttctccacatttaaatgtgtgagctt |
50512462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 54029587 - 54029655
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||| |||| | ||| |||||| ||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
54029587 |
atattatatgtagggaccggagttcgaatcccggacactccacttctccacaattaaattgtgtgagct |
54029655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 91
Target Start/End: Complemental strand, 56087987 - 56087899
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || |||||| ||||||||| | ||||||||||| ||||| |||||||| | | ||||||||| ||||||||| |
|
|
| T |
56087987 |
ttatatgcaggggccggggttcgaatcccggacaccccacttctccacaattaaattgtgtgagttctagccactagactacttgacaa |
56087899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 542850 - 542795
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacattta |
56 |
Q |
| |
|
||||| |||||||||||||| ||||||| ||||||||| ||||||||||||||| |
|
|
| T |
542850 |
atattgtatgcaggggctggggttcgaacttcggacactccacttctccacattta |
542795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 91
Target Start/End: Original strand, 2870922 - 2871008
Alignment:
| Q |
5 |
tatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaa-atgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||| |||||||| |||||||||| |||| | ||||||||| |||||| |||||||||||||||||||||||| | ||||||| |
|
|
| T |
2870922 |
tatatgtaggggctgaggttcgaaccccaaacac-ctacttctccaaatttaatatgtgtgagcttcaaccactagactatttgacaa |
2871008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 3815094 - 3815145
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccaca |
52 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||| |||| ||||||||||| |
|
|
| T |
3815094 |
atattatatgcaggagctggggttcgaaccccggatactccacttctccaca |
3815145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 23 - 89
Target Start/End: Original strand, 10141039 - 10141106
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
10141039 |
ttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
10141106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 13264310 - 13264219
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||| || | || |||||||||||||||| | |||||| |||| ||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
13264310 |
atattatatgcaaggaccggggttcgaaccccggacaccccacttcttcacaattaaattgtgtgagctctagccactagactacttgacaa |
13264219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 37935895 - 37935986
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||||||| ||||||| || ||||| |||||||||| |||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
37935895 |
atattatatgcaggggctggggttcgaactccagacacaacacttctccacaatttaattgtgtgagctctagccactaggctacttgacaa |
37935986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 10 - 68
Target Start/End: Original strand, 48798321 - 48798380
Alignment:
| Q |
10 |
gcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||| |||||||||||||||||| | ||||||||| ||||| |||||||||| |
|
|
| T |
48798321 |
gcaggggctggggttcgaaccccggacactccatttctccacaattaaattgtgtgagct |
48798380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 23 - 89
Target Start/End: Original strand, 48950840 - 48950907
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
48950840 |
ttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
48950907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 51777878 - 51777945
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||||||| || ||||||| ||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
51777878 |
atattatatgcagggatcggggttcgaactccggacatcccacttctccacatttaaatgtgtgagct |
51777945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 53572363 - 53572296
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagc |
67 |
Q |
| |
|
|||||||||||||| || || ||| |||||||||||||| |||||||||| |||||| ||||||||| |
|
|
| T |
53572363 |
atattatatgcaggagccgggattcaaaccccggacactccacttctccacaatttaattgtgtgagc |
53572296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 91
Target Start/End: Complemental strand, 1817275 - 1817225
Alignment:
| Q |
42 |
acttctccacatttaa-atgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| ||||||||| ||||||||| |
|
|
| T |
1817275 |
acttctccacatttaacatgtgcgagcttcagccactagactacttgacaa |
1817225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 3847715 - 3847773
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
|||||||||||||| || || ||||| |||||||||||| ||||||||||| |||||| |
|
|
| T |
3847715 |
atattatatgcaggagccggggttcgatccccggacactccacttctccacaattaaat |
3847773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 65
Target Start/End: Original strand, 12625869 - 12625927
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtga |
65 |
Q |
| |
|
|||||||||| ||| ||||||| |||||||| | |||||||||||||||| ||||||| |
|
|
| T |
12625869 |
tatgcaggggtcggagttcgaacaccggacaccccacttctccacatttaattgtgtga |
12625927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 17815461 - 17815371
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||| || |||||| ||| ||||| | ||||||||| ||||| |||||||||||| | |||||| | ||||||||| |
|
|
| T |
17815461 |
atattatatgcaggggtcggggttcgaatccctgacaccctacttctccatatttatatgtgtgagctttagccactaagctacttgacaa |
17815371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 23705189 - 23705131
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
|||||| ||||||| ||||| ||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
23705189 |
atattacatgcaggagctggggttcgaaccccggacacttcacttctccacaattaaat |
23705131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 65
Target Start/End: Original strand, 30263820 - 30263858
Alignment:
| Q |
27 |
aaccccggacactcaacttctccacatttaaatgtgtga |
65 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
30263820 |
aacctcggacacccaacttctccacatttaaatgtgtga |
30263858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 65
Target Start/End: Complemental strand, 30288367 - 30288329
Alignment:
| Q |
27 |
aaccccggacactcaacttctccacatttaaatgtgtga |
65 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
30288367 |
aacctcggacacccaacttctccacatttaaatgtgtga |
30288329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 65
Target Start/End: Complemental strand, 45139911 - 45139853
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtga |
65 |
Q |
| |
|
||||||||||| || |||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
45139911 |
tatgcaggggccggggttcgaaccccggacacctcacttctccacatttaattgtgtga |
45139853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 68
Target Start/End: Complemental strand, 53921518 - 53921476
Alignment:
| Q |
26 |
gaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
53921518 |
gaaccccggacaccccacttctccacatttaactgtgtgagct |
53921476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 23 - 68
Target Start/End: Original strand, 2629635 - 2629680
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| |||| | |||||||||||||||| |||||||||| |
|
|
| T |
2629635 |
ttcgaaccccgaacaccccacttctccacatttaattgtgtgagct |
2629680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 14 - 78
Target Start/End: Original strand, 3161069 - 3161134
Alignment:
| Q |
14 |
gggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccacta |
78 |
Q |
| |
|
|||||| | |||||| |||||||||| |||||||||||||| ||||||||||||| || |||||| |
|
|
| T |
3161069 |
gggctgtagttcgaatcccggacacttcacttctccacatttaaaatgtgtgagctacagccacta |
3161134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 4234321 - 4234232
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||| ||||||||| |||| |||||| ||||| |||||||||| | ||| ||||| ||||||| |
|
|
| T |
4234321 |
atattatatgcaggagccggggttcgaacctcggacactccacttttccacaattaaattgtgtgagctctagccattagactacttgac |
4234232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 8089287 - 8089222
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaa-atgtgtga |
65 |
Q |
| |
|
|||||||||||||||| ||| ||||||| ||||||||| | |||||||||||||| |||||||| |
|
|
| T |
8089287 |
atattatatgcaggggtcggagttcgaacttcggacactccatttctccacatttaatatgtgtga |
8089222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 33 - 89
Target Start/End: Complemental strand, 12775243 - 12775186
Alignment:
| Q |
33 |
ggacactcaacttctccacatttaaat-gtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||| ||||||||||| |||||| |||||||||| | ||||||||| ||||||| |
|
|
| T |
12775243 |
ggacactccacttctccacaattaaattgtgtgagctttacccactagactacttgac |
12775186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 23 - 91
Target Start/End: Original strand, 15208578 - 15208647
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| ||||| |||||||||| | ||| ||||| ||||||||| |
|
|
| T |
15208578 |
ttcgaacctcggacactccacttctccacaattaaattgtgtgagctctagccaatagactacttgacaa |
15208647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 68
Target Start/End: Complemental strand, 29329856 - 29329791
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||| |||||| || |||||||||| ||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
29329856 |
ttatatgtaggggccggggttcgaaccccagacactccacttctccacaattaaattgtgtgagct |
29329791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 23 - 68
Target Start/End: Original strand, 31852405 - 31852450
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||| | ||||||||| |||||| |||||||||| |
|
|
| T |
31852405 |
ttcgaaccccggacaccccacttctccatatttaattgtgtgagct |
31852450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 89
Target Start/End: Complemental strand, 33933771 - 33933686
Alignment:
| Q |
5 |
tatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaa-atgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||| || ||||| ||| |||||| | |||||||||||||||| ||||||||||| | ||||||| | ||||||| |
|
|
| T |
33933771 |
tatatgcaggggccggggttcgacccctggacaccccacttctccacatttaatatgtgtgagctatagccactaggctacttgac |
33933686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 35 - 68
Target Start/End: Complemental strand, 38767586 - 38767553
Alignment:
| Q |
35 |
acactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
38767586 |
acactcaacttctccatatttaaatgtgtgagct |
38767553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 40994139 - 40994050
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||| ||| | ||| |||||| ||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
40994139 |
atattatatgtaggagttggggttcgaatcccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
40994050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 42081775 - 42081836
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
|||| ||||||||| |||||| | |||||||| |||||||||||||||| |||||||||| |
|
|
| T |
42081775 |
tatgtaggggctggggttcgaatcttggacactccacttctccacatttaattgtgtgagct |
42081836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 68
Target Start/End: Complemental strand, 42334097 - 42334032
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||| ||| || ||| |||||||||||||||||| ||||||||| | ||||| |||||||||| |
|
|
| T |
42334097 |
ttatatgtaggagccggaattcgaaccccggacactccacttctccataattaaattgtgtgagct |
42334032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 23 - 68
Target Start/End: Original strand, 43905766 - 43905811
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||| | |||||||||| ||||| |||||||||| |
|
|
| T |
43905766 |
ttcgaaccccggacaccccacttctccacgtttaattgtgtgagct |
43905811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 38
Target Start/End: Original strand, 3465615 - 3465651
Alignment:
| Q |
2 |
tattatatgcaggggctggatttcgaaccccggacac |
38 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
3465615 |
tattatatgcaggggccggagttcgaaccccggacac |
3465651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 13551034 - 13551121
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| | | |||||||||||| ||| || |||||| |||||||||| ||||||||| |||||||| || ||||||| |
|
|
| T |
13551034 |
atattatatgcaggtgtcgtgtttcgaaccccgaacattccacttcttcacatttaaa-atgtgagctttaaccactaaactacttgac |
13551121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 52
Target Start/End: Complemental strand, 15604073 - 15604025
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccaca |
52 |
Q |
| |
|
||||||||||||| || |||||||||||||||||| ||||||||||| |
|
|
| T |
15604073 |
ttatatgcaggggtcgggattcgaaccccggacactccacttctccaca |
15604025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 22819442 - 22819510
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| ||||| |||||||||| ||||||| |||| | ||| |||||| |||||||||| |
|
|
| T |
22819442 |
atattatatgcaggagctggggttcgaaccccagacactccactttttcacaatttaattgtgtgagct |
22819510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 79
Target Start/End: Complemental strand, 23176754 - 23176679
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||||||||| || |||||||||||||||| | | |||||||||||| ||||||||||||| || ||||||| |
|
|
| T |
23176754 |
ttatatgcaggggtcggggttcgaaccccggacacccca-ttctccacatttaaaatgtgtgagctccagccactag |
23176679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 71
Target Start/End: Original strand, 25224512 - 25224576
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttca |
71 |
Q |
| |
|
|||||||||| ||| |||||||| ||||||| | |||||| || ||||| |||||||||||||| |
|
|
| T |
25224512 |
tatgcaggggtcggagttcgaacctcggacaccccacttcttcatatttatatgtgtgagcttca |
25224576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 91
Target Start/End: Complemental strand, 29505768 - 29505680
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||| ||| || |||||| ||||||||||| ||||||| ||| ||||| |||||||||| | |||||| || ||||||||| |
|
|
| T |
29505768 |
ttatatgcagaggccggggttcgaatcccggacactccacttctcgacaattaaattgtgtgagctctagccactaaactacttgacaa |
29505680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 33107390 - 33107470
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactaga |
80 |
Q |
| |
|
|||||||||| ||||| ||| |||||| |||| |||||| |||||||||| |||||| |||| ||||| |||||||||| |
|
|
| T |
33107390 |
atattatatgtgggggccggagttcgaatcccgaacactccacttctccacaatttaattgtgcgagctctaaccactaga |
33107470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 79
Target Start/End: Complemental strand, 46791222 - 46791166
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||| |||||||| | |||||| ||||||||| | ||||||||||| ||||||| |
|
|
| T |
46791222 |
ttcgaactccggacaccccacttcttcacatttaattctgtgagcttcagccactag |
46791166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 48615508 - 48615440
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||| || || ||||||||||||| |||| ||||||||||| ||||| |||||||||| |
|
|
| T |
48615508 |
atattatatgcagaagccggggttcgaaccccggatactccacttctccacaattaaattgtgtgagct |
48615440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 91
Target Start/End: Complemental strand, 48825851 - 48825764
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat-gtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||| || || || ||||||||||||||| ||| ||||||| |||||| ||||||||| ||||||||||| |||| |||| |
|
|
| T |
48825851 |
ttatatgcaggagccggggttagaaccccggacactccact-ctccacaattaaattgtgtgagctctaaccactagactacttaacaa |
48825764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 59
Target Start/End: Complemental strand, 51512023 - 51511987
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
51512023 |
ttcgaaccccggacactccacttctccacaattaaat |
51511987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 38
Target Start/End: Original strand, 53815728 - 53815764
Alignment:
| Q |
2 |
tattatatgcaggggctggatttcgaaccccggacac |
38 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
53815728 |
tattatatgcaggggctggggttcgaaccccggacac |
53815764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 2e-20; HSPs: 85)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 3287092 - 3287002
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||||| || ||||||||||||| |||| |||||||||||||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
3287092 |
atattatatgcaggggccggggttcgaaccccggatactccacttctccacatttaattgtgtgagctctagccactagactacttgacaa |
3287002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 28194666 - 28194734
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| | ||||||||||| ||||| |||||||||| |
|
|
| T |
28194666 |
atattatatgcaggggctggagttcgaaccccggacaccccacttctccacaattaaattgtgtgagct |
28194734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 1309162 - 1309073
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
1309162 |
atattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
1309073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 36182676 - 36182765
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| ||||||||| | ||||||| |
|
|
| T |
36182676 |
atattatatgcaggagcaggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactaggctacttgac |
36182765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 40535485 - 40535396
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
40535485 |
atattatatgcaggggccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
40535396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 19281642 - 19281710
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
19281642 |
atattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
19281710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 4 - 91
Target Start/End: Original strand, 32854569 - 32854657
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||| |||| || |||||||||||||||| | |||||||||||||| ||||||||||||| || ||||||| | ||||||||| |
|
|
| T |
32854569 |
ttatatgcaagggccggggttcgaaccccggacaccctacttctccacatttaaaatgtgtgagctccagccactaggctacttgacaa |
32854657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 34614013 - 34614081
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
34614013 |
atattatatgcaggggccggggttcgaaccccggacactctacttctccacaattaaattgtgtgagct |
34614081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 4659442 - 4659532
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||| ||||||||| ||||||| |||||||| | ||||||||||||||| ||||||||||| | ||| ||||| ||||||||| |
|
|
| T |
4659442 |
atattatatataggggctggggttcgaactccggacaccccacttctccacatttatatgtgtgagctctagccattagactacttgacaa |
4659532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 4878243 - 4878333
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||| |||||| | |||||||||||||||| | ||||||||||||||| ||||||||||| | ||||||| | ||||||||| |
|
|
| T |
4878243 |
atattatatgtaggggccagggttcgaaccccggacaccccacttctccacatttatatgtgtgagctctagccactaggctacttgacaa |
4878333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 7 - 65
Target Start/End: Original strand, 44558042 - 44558100
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtga |
65 |
Q |
| |
|
|||||||||||||| |||||||||||||||| | |||||||||||||||| ||||||| |
|
|
| T |
44558042 |
tatgcaggggctggggttcgaaccccggacaccccacttctccacatttaattgtgtga |
44558100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 5612988 - 5613077
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||| |||| || |||||||||||||||| | |||||||||| |||||| |||||||||| ||||||||| | ||||||| |
|
|
| T |
5612988 |
atattatatgcaagggccggggttcgaaccccggacaccccacttctccacaatttaattgtgtgagctctaaccactaggctacttgac |
5613077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 23 - 91
Target Start/End: Original strand, 13773456 - 13773525
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||| |||||||||| ||||||||| | ||||||||| |
|
|
| T |
13773456 |
ttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactaggctacttgacaa |
13773525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 20296452 - 20296541
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
20296452 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
20296541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 31223654 - 31223723
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagctt |
69 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||| |||||||||| |||||| ||||||||||| |
|
|
| T |
31223654 |
atattatatgcaggggctggggtttgaaccccagacactccacttctccacaatttaattgtgtgagctt |
31223723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 33228969 - 33228880
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| | ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
33228969 |
atattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
33228880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 88
Target Start/End: Complemental strand, 40688672 - 40688587
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttga |
88 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||| ||||||||||| ||||| |||||||||| ||||||||| | |||||| |
|
|
| T |
40688672 |
ttatatgcaggggccagggttcgaaccccggacactctacttctccacaattaaattgtgtgagctctaaccactaggctacttga |
40688587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 41509550 - 41509639
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
41509550 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
41509639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 41566796 - 41566885
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||| |||| |||||| ||| ||||||| |||||||||| |||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
41566796 |
atattatatgcaggggttggagttcgaatcccagacactccacttctccacaatttaattgtgtgagctctagccactaggctacttgac |
41566885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 23 - 88
Target Start/End: Complemental strand, 44666357 - 44666292
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttga |
88 |
Q |
| |
|
||||||||||||||| || ||||||||||| |||| |||||||||| ||||||||||| |||||| |
|
|
| T |
44666357 |
ttcgaaccccggacattccacttctccacaattaattgtgtgagctctaaccactagaccacttga |
44666292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 2643731 - 2643799
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
2643731 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
2643799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 4562788 - 4562720
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
4562788 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
4562720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 22718097 - 22718029
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat-gtgtgagct |
68 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||| |||||| ||||||||||| |||||| ||||||||| |
|
|
| T |
22718097 |
atattatatgcaggagctggggttcgaaccccgaacactccacttctccacaattaaatcgtgtgagct |
22718029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 27082354 - 27082422
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||| ||| |||||| || |||||||| |||||||||| |||||| |||||||||| |
|
|
| T |
27082354 |
atattatatgcaggggccggagttcgaaacctggacactccacttctccacaatttaattgtgtgagct |
27082422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 30390405 - 30390317
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttga |
88 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||| | |||||||||| |||||| |||||||||| ||||||||| | |||||| |
|
|
| T |
30390405 |
atattatatgcaggagccggggttcgaaccccggacaccctacttctccacaatttaattgtgtgagctctaaccactaggctacttga |
30390317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 1844851 - 1844942
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||||| || |||||||| ||||||| | ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
1844851 |
atattatatgcaggggccggggttcgaacctcggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
1844942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 23 - 78
Target Start/End: Original strand, 3596306 - 3596361
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccacta |
78 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||| |||||||||| || |||||| |
|
|
| T |
3596306 |
ttcgaaccccggacaccccacttctccacatttaattgtgtgagctccagccacta |
3596361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 1071504 - 1071562
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
1071504 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaat |
1071562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 1500995 - 1501084
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||| ||||||||| | || ||| |||||||| | ||| ||||| ||||||||| |
|
|
| T |
1500995 |
atattatatgcaggggctggggttcgaaccccagacactccacttctccataatttaat-tgtgagctctagccaatagactacttgacaa |
1501084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 17487738 - 17487796
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
17487738 |
atattatatgcagtggctggggttcgaaccccggacacttcacttctccacaattaaat |
17487796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 6 - 91
Target Start/End: Original strand, 18862291 - 18862377
Alignment:
| Q |
6 |
atatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||| |||||| || |||||||||| ||||||| |||||||||||||| ||||||||||||| | ||||||| | ||||||||| |
|
|
| T |
18862291 |
atatgtaggggcaggggttcgaacccccgacactccacttctccacatttaaaatgtgtgagctctagccactaggctacttgacaa |
18862377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 34355755 - 34355833
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccacta |
78 |
Q |
| |
|
||||||||||||||||| || |||||||||| ||||||| |||||||||| |||||| ||| |||||| |||||||| |
|
|
| T |
34355755 |
atattatatgcaggggccggggttcgaaccccagacactccacttctccacaatttaattgtatgagctctaaccacta |
34355833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 3438982 - 3439063
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagac |
81 |
Q |
| |
|
|||||||||||||| | || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||||| |
|
|
| T |
3438982 |
atattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactagac |
3439063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 6331596 - 6331684
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || || |||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
6331596 |
atattatatgcaggagccgggtt-cgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
6331684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 56
Target Start/End: Complemental strand, 6859235 - 6859186
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacattta |
56 |
Q |
| |
|
|||||||||| | || |||||||||||||||| ||||||||||||||||| |
|
|
| T |
6859235 |
tatgcaggggtttgagttcgaaccccggacacccaacttctccacattta |
6859186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 8250337 - 8250248
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||||||| || |||||||||| |||||| || |||||||| ||||| |||||||||| |||||||||| ||||||| |
|
|
| T |
8250337 |
atattatatgcaggggccggggttcgaaccccagacacttcacctctccacaattaaattgtgtgagctctaaccactagaatacttgac |
8250248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 15233447 - 15233512
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgag |
66 |
Q |
| |
|
||||||||||||||||| ||| ||| |||||| ||||||| ||||||| ||| |||| |||||||| |
|
|
| T |
15233447 |
atattatatgcaggggccggagttcaaaccccagacactccacttctctacagttaattgtgtgag |
15233512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 17777199 - 17777142
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa |
58 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||| | ||||||||||||||||| |
|
|
| T |
17777199 |
atattatatgcaggggtcggggttcgaaccccggacaccccacttctccacatttaaa |
17777142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 4 - 68
Target Start/End: Complemental strand, 20497228 - 20497163
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagct |
68 |
Q |
| |
|
||||||| ||||||||| |||||| ||||||||| | |||||||||||||| ||||||||||||| |
|
|
| T |
20497228 |
ttatatgtaggggctggggttcgaatcccggacaccccacttctccacatttaaaatgtgtgagct |
20497163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 23 - 91
Target Start/End: Complemental strand, 28153156 - 28153087
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||| | ||||||||||| ||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
28153156 |
ttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactagactacttgacaa |
28153087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 4 - 68
Target Start/End: Original strand, 29449485 - 29449550
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || |||||||||| ||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
29449485 |
ttatatgcaggggccggggttcgaaccccagacactctacttctccacaattaaattgtgtgagct |
29449550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 3446764 - 3446828
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtga |
65 |
Q |
| |
|
|||||||||||||| || | |||||||||||||||| | ||||||||||||||| |||||||| |
|
|
| T |
3446764 |
atattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
3446828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 79
Target Start/End: Original strand, 5947903 - 5947979
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||||||||| || |||||||||||||||| | ||| |||||||||| ||||||||||||| || ||||||| |
|
|
| T |
5947903 |
ttatatgcaggggtcggggttcgaaccccggacaccccactcctccacatttaaaatgtgtgagctccagccactag |
5947979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 11050793 - 11050725
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||| | ||||||||| | ||||| |||||||||| |
|
|
| T |
11050793 |
atattatatgcaggggctggggttcgaactccggacaccccacttctccataattaaattgtgtgagct |
11050725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 11093824 - 11093756
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| | || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
11093824 |
atattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
11093756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 79
Target Start/End: Original strand, 18254626 - 18254702
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||| || ||||||| || ||||| | |||||| ||||||| ||||||||||||| |||||||||| |
|
|
| T |
18254626 |
ttatatgcaggggccggggttcgaactccagacaccccacttcttcacatttaaaatgtgtgagctccaaccactag |
18254702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 18278453 - 18278385
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || |||||| ||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
18278453 |
atattatatgcaggagccggggttcgaatcccggacactccacttctccacaattaaattgtgtgagct |
18278385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 19684107 - 19684174
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| ||||| |||||||||| ||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
19684107 |
atattatatgcaggagctggggttcgaacccc-gacactccacttctccacaattaaattgtgtgagct |
19684174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 25857331 - 25857275
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaa |
57 |
Q |
| |
|
|||||||||||||| ||||| ||||||| |||||||||| ||||||||||| |||| |
|
|
| T |
25857331 |
atattatatgcaggagctggggttcgaacaccggacactccacttctccacaattaa |
25857275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 27297209 - 27297277
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||| |||||||| ||||| |||||||||||||||||| ||||||||| | ||||| |||||||||| |
|
|
| T |
27297209 |
atattgtatgcaggagctgggattcgaaccccggacactccacttctccataattaaactgtgtgagct |
27297277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 36005476 - 36005544
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || |||||||||| ||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
36005476 |
atattatatgcaggagccggggttcgaaccccagacactccacttctccacaattaaattgtgtgagct |
36005544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 23 - 91
Target Start/End: Original strand, 40403606 - 40403674
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||| ||||| ||||||||||| |||| |||||||||| |||||||| || ||||||||| |
|
|
| T |
40403606 |
ttcgaaccccgaacactacacttctccacaattaattgtgtgagctctaaccactaaactacttgacaa |
40403674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 8742860 - 8742769
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||| |||||| |||| | ||| |||||| ||||||| || | ||||||||| ||||||||| |
|
|
| T |
8742860 |
atattatatgtaggggctggggttcgaaccccgcacactccactttttcacaatttaattgtgtgaactctagccactagactacttgacaa |
8742769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 22653680 - 22653589
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| | || |||||||||||||||||| ||||||||||| ||||| ||| |||||| | ||||||||| | ||||||| |
|
|
| T |
22653680 |
atattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtatgagctctagccactagactatttgacaa |
22653589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 23984256 - 23984181
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccacta |
78 |
Q |
| |
|
|||||||||||||| | |||||||||||||||| | |||||||||||||| |||||||||| || || |||||| |
|
|
| T |
23984256 |
ttatatgcaggggccagggttcgaaccccggacaccccacttctccacatttaaaatgtgtgaactccagccacta |
23984181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 33816452 - 33816373
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactaga |
80 |
Q |
| |
|
|||||||||||||||| || |||||||||||| |||| | | ||||| ||||||| ||||||||||| | |||||||| |
|
|
| T |
33816452 |
atattatatgcaggggtcgggtttcgaaccccgaacaccccatttctctacatttatctgtgtgagctttatccactaga |
33816373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 23 - 89
Target Start/End: Complemental strand, 35429623 - 35429556
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||| ||||| ||||||| || ||||||| | ||||||| |
|
|
| T |
35429623 |
ttcgaacccctgacactccacttctccacatttaaaatgcgtgagctgcatccactaggctacttgac |
35429556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 44186477 - 44186568
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||| ||||| |||||||| ||||||| | ||||||||||| ||||| |||||||||| | |||| |||| ||||||||| |
|
|
| T |
44186477 |
atattatatgcagcggctgtggttcgaacctcggacaccccacttctccacaattaaattgtgtgagctctagccaccagactacttgacaa |
44186568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 44857270 - 44857179
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctcca-catttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||| ||||||||| |||||| ||||| |||| | ||||||| | ||||||||| |
|
|
| T |
44857270 |
atattatatgcaggggccgaggttcgaaccccggacactccacttctccataatttaattgtgtaagctctagccactaggctacttgacaa |
44857179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 81
Target Start/End: Complemental strand, 7717638 - 7717560
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactagac |
81 |
Q |
| |
|
||||||||||||| || ||||||| ||||||||| |||||||||||||| ||||||||||||| | ||||||||| |
|
|
| T |
7717638 |
ttatatgcaggggtcggggttcgaacttcggacactccacttctccacatttaaaatgtgtgagctccggccactagac |
7717560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 29942162 - 29942072
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||| ||| || |||||| | |||||||| ||||||||| |||||| |||||||||| | | ||||||| ||||||||| |
|
|
| T |
29942162 |
atattatatgcagaggcgggggttcgaattctggacactccacttctccatatttaattgtgtgagctctagcaactagactacttgacaa |
29942072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 33549090 - 33548997
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaac--cactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| ||||| |||||||||| ||||| ||||||||||| ||||| |||||||||| ||| |||||||| ||||||||| |
|
|
| T |
33549090 |
atattatatgcaggagctggggttcgaaccccaaacacttcacttctccacaattaaattgtgtgagctctaactgcactagactacttgacaa |
33548997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 35972595 - 35972537
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||| |||||||| || |||||| |
|
|
| T |
35972595 |
atattttatgcaggggctggggttcgaaccccggacacttcacttctccgcaattaaat |
35972537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 36101693 - 36101769
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| | |||| | || ||| ||||||||||||| || ||||||| |
|
|
| T |
36101693 |
atattatatgcaggggctggggttcgaaccccggacaccccactt-taca-attaaaatgtgtgagctccagccactag |
36101769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 1964393 - 1964454
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| || ||| |||||||||||| | ||||||||| |||||| |||||||||| |
|
|
| T |
1964393 |
tatgcaggggccggggttcaaaccccggacaccccacttctccatatttaattgtgtgagct |
1964454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 27 - 91
Target Start/End: Complemental strand, 9985129 - 9985064
Alignment:
| Q |
27 |
aaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||| |||| | |||||||||| |||||| ||||||| |||||||||||| || ||||||||| |
|
|
| T |
9985129 |
aaccccgaacaccccacttctccacgtttaaaatgtgtgaacttcaaccactaaactacttgacaa |
9985064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 10679412 - 10679355
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa |
58 |
Q |
| |
|
||||||||| | |||||||| |||||||| | ||| ||||||||||||||||||||| |
|
|
| T |
10679412 |
atattatattcgggggctggggttcgaacctcagacgctcaacttctccacatttaaa |
10679355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 79
Target Start/End: Original strand, 14518324 - 14518397
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||||||| || |||||||| || |||||| ||||||||| |||| ||||||||||||| || ||||||| |
|
|
| T |
14518324 |
tatgcaggggccggggttcgaacctcgaacactccacttctccatatttaaaatgtgtgagctccagccactag |
14518397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 15939345 - 15939402
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||||||| |||| | |||||||||||||| ||||||||||||| || ||||||| |
|
|
| T |
15939345 |
ttcgaaccccgaacaccccacttctccacatttaaaatgtgtgagctccagccactag |
15939402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 42 - 79
Target Start/End: Original strand, 17524913 - 17524950
Alignment:
| Q |
42 |
acttctccacatttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
17524913 |
acttctccacatttaaatgtgtgagctccagccactag |
17524950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 18694819 - 18694908
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| |||| |||||| ||| ||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
18694819 |
atattatatgcaggaactggggttcgaatcccagacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
18694908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 23 - 68
Target Start/End: Original strand, 20919666 - 20919711
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||| | |||||||| |
|
|
| T |
20919666 |
ttcgaaccccggacaccccacttctccacatttaattatgtgagct |
20919711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 42 - 91
Target Start/End: Original strand, 27444334 - 27444383
Alignment:
| Q |
42 |
acttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||| |||||||||||||||||||| || |||||||| ||||||||| |
|
|
| T |
27444334 |
acttcttcacatttaaatgtgtgagctctaatcactagactacttgacaa |
27444383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 89
Target Start/End: Complemental strand, 27497561 - 27497476
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||| |||||||| || ||||| | |||| | |||||||||||||||| | |||||||| ||||||||| | ||||||| |
|
|
| T |
27497561 |
ttatatgcaagggctggagtttgaacctcaaacaccccacttctccacatttaattatgtgagctctaaccactagcctacttgac |
27497476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 68
Target Start/End: Complemental strand, 28692518 - 28692453
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||||| || ||||||||| |||||||| |||||||||| |||||| |||||||||| |
|
|
| T |
28692518 |
ttatatgcaggggtcggggttcgaacccaggacactccacttctccacaatttaattgtgtgagct |
28692453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 23 - 91
Target Start/End: Original strand, 39635356 - 39635425
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||| || ||||||| |||||||||||||| |||||||||| || || ||||||||| |||| |||| |
|
|
| T |
39635356 |
ttcgaactccagacactccacttctccacatttaaaatgtgtgatctccagccactagactacttaacaa |
39635425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 68
Target Start/End: Complemental strand, 40473583 - 40473518
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||| || ||||| ||||||| | ||||||||||| ||||| |||||||||| |
|
|
| T |
40473583 |
ttatatgcaggggctggggtttgaacctcggacaccccacttctccacaattaaattgtgtgagct |
40473518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 58
Target Start/End: Complemental strand, 42998884 - 42998831
Alignment:
| Q |
5 |
tatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa |
58 |
Q |
| |
|
||||||||||||| ||| ||||||| |||||||| | |||||||| |||||||| |
|
|
| T |
42998884 |
tatatgcaggggccggagttcgaactccggacacccgacttctccgcatttaaa |
42998831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 91
Target Start/End: Original strand, 44822460 - 44822549
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||| || || |||||||||| ||||||| |||||||||| ||||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
44822460 |
ttatatgcaggagccggggttcgaaccccagacactccacttctccacaatttaaattgtgtgagctctagccactaggctacttgacaa |
44822549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 45119743 - 45119686
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa |
58 |
Q |
| |
|
|||||||||||||||| ||| |||||||| ||||||||| | ||||||| ||||||| |
|
|
| T |
45119743 |
atattatatgcaggggtcggagttcgaacctcggacactccatttctccatatttaaa |
45119686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 7281724 - 7281657
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||| | | |||||| ||||||||||| ||||||| ||| ||||| |||||||||| |
|
|
| T |
7281724 |
atattatatgcaggggccg-agttcgaatcccggacactccacttctctacaattaaattgtgtgagct |
7281657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 9330537 - 9330469
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||||| | ||||| |||||||||| |||| |||||| ||||| |||||||||| |
|
|
| T |
9330537 |
atattatatgcaggggctgaggtgcgaactccggacactccacttatccacaattaaattgtgtgagct |
9330469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 27016311 - 27016379
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||| |||||| ||| ||||||||| |||||||| |||||||||| | |||| |||||||||| |
|
|
| T |
27016311 |
atattatatacaggggtcggagttcgaaccctggacactccacttctccacaacttaattgtgtgagct |
27016379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 79
Target Start/End: Original strand, 32221004 - 32221082
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt---aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||| || |||||||| ||||||| | |||| ||||||||| ||||||||||||| || ||||||| |
|
|
| T |
32221004 |
ttatatgcaggggccggggttcgaacctcggacaccccacttttccacatttaaaaaatgtgtgagctccagccactag |
32221082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 39408726 - 39408658
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||| | || || |||||||||| ||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
39408726 |
atattatatgcaagagccggggttcgaaccccagacactccacttctccacaattaaattgtgtgagct |
39408658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 2e-20; HSPs: 131)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 36314015 - 36313925
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||| ||||||||| ||| ||||||||||| |||| | ||||||||||||| |||||||||||| |||||||||||| ||||||||| |
|
|
| T |
36314015 |
atattatttgcaggggccggagttcgaaccccgaacaccccacttctccacattataatgtgtgagctccaaccactagactacttgacaa |
36313925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 3560417 - 3560328
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||||||||||| |||||||||| || |||| |||||||||| |||||| |||||||||| | ||||||||| ||||||| |
|
|
| T |
3560417 |
atattatatgcaggggctggagttcgaaccccagatactccacttctccacaatttaattgtgtgagctctagccactagactacttgac |
3560328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 7166263 - 7166174
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||| |||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
7166263 |
atattatatgcaggggctggggttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagccactaggctacttgac |
7166174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 6 - 88
Target Start/End: Complemental strand, 17671441 - 17671358
Alignment:
| Q |
6 |
atatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttga |
88 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||| ||||||||||| ||||| ||||||||||| | ||||||| | |||||| |
|
|
| T |
17671441 |
atatgcaggggccggagttcgaaccccggacactccacttctccacaattaaattgtgtgagctttagccactaggctacttga |
17671358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 22563420 - 22563511
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||| |||||||||| |||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
22563420 |
atattatatgcaggggccggggttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagccactaggctacttgacaa |
22563511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 7 - 92
Target Start/End: Original strand, 8741513 - 8741599
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacattta-aatgtgtgagcttcaaccactagacgacttgacaat |
92 |
Q |
| |
|
||||||||||| || |||||||||| ||||| | ||||||||||||||| |||||||||||| |||||||||| | |||||||||| |
|
|
| T |
8741513 |
tatgcaggggcaggggttcgaacccctgacaccccacttctccacatttataatgtgtgagctccaaccactaggctacttgacaat |
8741599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 4 - 81
Target Start/End: Complemental strand, 18512608 - 18512530
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactagac |
81 |
Q |
| |
|
|||||||||||||| || |||||||||||||||| | |||||||||||||| ||||||||||||| || ||||||||| |
|
|
| T |
18512608 |
ttatatgcaggggccggggttcgaaccccggacaccccacttctccacatttaaaatgtgtgagctccagccactagac |
18512530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 11333704 - 11333765
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| ||| |||||||||||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
11333704 |
tatgcaggggccggagttcgaaccccggacaccccacttctccacatttaattgtgtgagct |
11333765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 11491725 - 11491786
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| ||| |||||||||||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
11491725 |
tatgcaggggccggagttcgaaccccggacaccccacttctccacatttaattgtgtgagct |
11491786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 25999884 - 25999973
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||| ||||||||||| ||||| |||||||||| | |||||||| ||||||| |
|
|
| T |
25999884 |
atattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactagattacttgac |
25999973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 27178744 - 27178667
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccacta |
78 |
Q |
| |
|
||||||||||||||||| ||| |||||| | ||||||| | ||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
27178744 |
atattatatgcaggggccggaattcgaatctcggacaccccacttctccacattaaaatgtgtgagctctaaccacta |
27178667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 7180650 - 7180582
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||| | ||||||||||| ||||| |||||||||| |
|
|
| T |
7180650 |
atattatatgcaggggccggagttcgaaccccggacaccccacttctccacaattaaattgtgtgagct |
7180582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 18467234 - 18467166
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||| |||||||||| |||||| |||||||||| |
|
|
| T |
18467234 |
atattatatgcaggggctggggttcgaaccccagacactccacttctccacaatttaattgtgtgagct |
18467166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 23 - 79
Target Start/End: Complemental strand, 26909884 - 26909828
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||||| |||||| | |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26909884 |
ttcgaaccctggacaccccacttctccacatttaaatgtgtgagcttcagccactag |
26909828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 4 - 91
Target Start/End: Complemental strand, 27642759 - 27642672
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||| ||||| ||||||||| |||||||| ||||||||||| ||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
27642759 |
ttatatgcaggg-ctggagttcgaaccctggacactccacttctccacaattaaattgtgtgagctctagccactagactacttgacaa |
27642672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 7 - 79
Target Start/End: Complemental strand, 47469103 - 47469031
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||||||||| |||||||||||||||| | |||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
47469103 |
tatgcaggggctgaggttcgaaccccggacaccccacttctccacatttaattgtgtgagctctaaccactag |
47469031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 4482634 - 4482543
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || ||| ||||||||||||| |||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
4482634 |
atattatatgcaggagccggagttcgaaccccggatactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
4482543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 12048160 - 12048069
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||| | ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
12048160 |
atattatatgcaggggctggggttcgaatcccggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
12048069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 13763798 - 13763873
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccacta |
78 |
Q |
| |
|
||||||||||||||||| ||||||||||||| || | ||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
13763798 |
ttatatgcaggggctggggttcgaaccccggataccccacttctctacatttaaaatgtgtgagcttcagccacta |
13763873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 19011389 - 19011480
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||||||| |||||||||| || |||| |||||||||| |||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
19011389 |
atattatatgcaggggctggggttcgaaccccagatactccacttctccacaatttaattgtgtgagctctagccactaggctacttgacaa |
19011480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 37662593 - 37662502
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat-gtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||| || | |||||||||||||| | ||||||| ||| |||||| ||||||||| |||||||||||| ||||||||| |
|
|
| T |
37662593 |
atattatatgcaggggtcggggtacgaaccccggacaccccacttctctacagttaaattgtgtgagctccaaccactagactacttgacaa |
37662502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 40375351 - 40375260
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || | |||||||||||||||| ||||||||||| ||||| |||||||||| ||||||||| | ||||||||| |
|
|
| T |
40375351 |
atattatatgcaggagccggggtacgaaccccggacactctacttctccacaattaaattgtgtgagctctaaccactaggctacttgacaa |
40375260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 50119006 - 50119073
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||| |||||||||| ||| |||||||||||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
50119006 |
atattttatgcaggggtcggagttcgaaccccggacaccccacttctccacatttaattgtgtgagct |
50119073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 13538482 - 13538416
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgag |
66 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||| |||||||||| |||||| |||||||| |
|
|
| T |
13538482 |
atattatatgcaggggccggggttcgaaccccggacactccacttctccacaatttaattgtgtgag |
13538416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 1570228 - 1570139
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
1570228 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
1570139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 6438100 - 6438011
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
6438100 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
6438011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 7191066 - 7191155
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
7191066 |
atattatatgcaggggctggggttcgaaccccggacacctcacttctccacaattaaattgtgtgagctctagccactagcctacttgac |
7191155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 11215035 - 11215124
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||| |||||||||| |||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
11215035 |
atattatatgcaggggctgaggttcgaaccccagacactccacttctccacaatttaattgtgtgagctctagccactaggctacttgac |
11215124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 15819637 - 15819548
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
15819637 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
15819548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 21265690 - 21265779
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| | ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
21265690 |
atattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
21265779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 29188670 - 29188759
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || ||||||||||||| |||| ||||||||||| ||||| |||||||||| | ||||||||| ||||||| |
|
|
| T |
29188670 |
atattatatgcaggagcaggggttcgaaccccggatactccacttctccacaattaaattgtgtgagctctagccactagactacttgac |
29188759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 5 - 89
Target Start/End: Complemental strand, 45333744 - 45333659
Alignment:
| Q |
5 |
tatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||| |||||||||| |||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
45333744 |
tatatgcaggggctggggttcgaaccccagacactccacttctccacaatttaattgtgtgagctctagccactaggctacttgac |
45333659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 23 - 79
Target Start/End: Complemental strand, 3742331 - 3742275
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| ||||||||| | |||||||||| |
|
|
| T |
3742331 |
ttcgaaccccggacaccccacttctccacatttacatgtgtgagttccaaccactag |
3742275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 15775773 - 15775841
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || ||| |||||||||| |||||||||||||| |||| ||||| |||||||||| |
|
|
| T |
15775773 |
atattatatgcaggagccggagttcgaaccccagacactcaacttctacacaattaaattgtgtgagct |
15775841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 16343062 - 16343130
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
16343062 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
16343130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 23 - 91
Target Start/End: Complemental strand, 28503543 - 28503475
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||| ||||||||| | |||||| |||||| |||||||||||||| ||||||||||| ||| ||||| |
|
|
| T |
28503543 |
ttcgaatcccggacaccctacttcttcacattaaaatgtgtgagctttaaccactagactactagacaa |
28503475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 34580822 - 34580742
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactaga |
80 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||| |||||||||| |||||| ||| |||||| |||||||||| |
|
|
| T |
34580822 |
atattatatgcaggagctggggttcgaaccccggacactttacttctccacaatttaattgtatgagctctaaccactaga |
34580742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 35068721 - 35068789
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagctt |
69 |
Q |
| |
|
|||||||||| |||||| || |||||||||||||||| | ||||||||||||| ||||||||||||| |
|
|
| T |
35068721 |
atattatatggaggggccggggttcgaaccccggacaccccacttctccacattagaatgtgtgagctt |
35068789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 4 - 91
Target Start/End: Original strand, 47088846 - 47088936
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa---tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||| ||| ||||| |||||||||| | |||||| || ||||||||| |
|
|
| T |
47088846 |
ttatatgcaggggctggggttcgaaccccggacactccacttctcgacaattaaattttgtgtgagctctagccactaaactacttgacaa |
47088936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 2277788 - 2277879
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || ||||||||||||| |||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
2277788 |
atattatatgcaggagccggggttcgaaccccggagactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
2277879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 13773202 - 13773293
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || |||||| ||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
13773202 |
atattatatgcaggagccggggttcgaatcccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
13773293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 16526213 - 16526122
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || | ||||||||||| |||||| ||||||||||| ||||| |||||||||| ||||||||| | ||||||||| |
|
|
| T |
16526213 |
atattatatgcaggagcctgtgttcgaaccccgtacactccacttctccacaattaaattgtgtgagctctaaccactaggctacttgacaa |
16526122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 19063369 - 19063278
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||||| || |||| ||||||||||| | |||||||||| |||||| |||||||||| ||| |||| || ||||||||| |
|
|
| T |
19063369 |
atattatatgcaggggccggggttcgtaccccggacaccccacttctccacaatttaattgtgtgagctctaactactaaactacttgacaa |
19063278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 24333598 - 24333649
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccaca |
52 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||| ||||||||||| |
|
|
| T |
24333598 |
atattatatgcaggggctggagttcgaaccccaaacactccacttctccaca |
24333649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 43884828 - 43884919
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || ||||||||| |||||||| ||||||||||| ||||| |||||||| | | ||||||||| ||||||||| |
|
|
| T |
43884828 |
atattatatgcaggagccggggttcgaaccctggacactccacttctccacaattaaattgtgtgagttctagccactagactacttgacaa |
43884919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 48897153 - 48897062
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctcca-catttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||||| | ||||||| |||||||||| ||||||||| |||||| |||||||||| ||||||||| | ||||||||| |
|
|
| T |
48897153 |
atattatatgcaggggccagggttcgaacaccggacactccacttctccataatttaattgtgtgagctctaaccactaggctacttgacaa |
48897062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 78
Target Start/End: Original strand, 51137824 - 51137895
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccacta |
78 |
Q |
| |
|
||||||||||| ||| ||||||| | ||||| | ||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
51137824 |
tatgcaggggccggagttcgaactctggacatcccacttctccacatttaaatgtgcgagctccaaccacta |
51137895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 16997295 - 16997205
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||| ||||||||||| | |||||||||||||||| ||||||||||||| || ||||||||||||| |||||| | ||||||||| |
|
|
| T |
16997295 |
atattttatgcaggggccgaggttcgaaccccggacacctcacttctccacattcaattgtgtgagcttcagccactacgctacttgacaa |
16997205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 7 - 69
Target Start/End: Complemental strand, 18607839 - 18607777
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagctt |
69 |
Q |
| |
|
|||||||||||||| ||||||||||| |||| | ||||||| |||||||| ||||||||||| |
|
|
| T |
18607839 |
tatgcaggggctggggttcgaaccccgaacaccccacttctctacatttaattgtgtgagctt |
18607777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 27784092 - 27784034
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||| ||||||||||| |||||| |
|
|
| T |
27784092 |
atattatatgcaggggctgtgattcgaaccctggacactccacttctccacaattaaat |
27784034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 4 - 89
Target Start/End: Original strand, 48638569 - 48638655
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||| | ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
48638569 |
ttatatgcaggggctggggttcgaaccccagacaccccacttctccacaattaaactgtgtgagctctagccactaggctacttgac |
48638655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 7 - 81
Target Start/End: Complemental strand, 49503180 - 49503106
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagac |
81 |
Q |
| |
|
||||||||||| ||| ||||||| |||||||| | | |||| ||||||||||||||||| || |||| ||||||| |
|
|
| T |
49503180 |
tatgcaggggccggagttcgaacgccggacaccccagttcttcacatttaaatgtgtgaactccaactactagac |
49503106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 2754394 - 2754483
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||| ||||| || |||||||||||||||| | ||||||||||| ||||| |||||||||| | |||||| || ||||||| |
|
|
| T |
2754394 |
atattatatgccggggccggggttcgaaccccggacaccctacttctccacaattaaattgtgtgagctctagccactaaactacttgac |
2754483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 10632750 - 10632807
Alignment:
| Q |
23 |
ttcgaaccccggacactca-acttctccacatttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10632750 |
ttcgaaccccggacacccccacttctccacatttaaatgtgtgagcttccgccactag |
10632807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 16182232 - 16182289
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa |
58 |
Q |
| |
|
|||||||||||| |||||||| |||||| |||| |||| | ||||||||||||||||| |
|
|
| T |
16182232 |
atattatatgcatgggctggagttcgaatcccgaacaccccacttctccacatttaaa |
16182289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 68
Target Start/End: Complemental strand, 23991294 - 23991233
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| || ||||||||| |||||| | |||||||||||||||| |||||||||| |
|
|
| T |
23991294 |
tatgcaggggccggggttcgaaccctggacaccccacttctccacatttaattgtgtgagct |
23991233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 3 - 91
Target Start/End: Complemental strand, 28564379 - 28564290
Alignment:
| Q |
3 |
attatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| ||| |||||||| ||||||| | ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
28564379 |
attatatgcaggggttggggttcgaacctcggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
28564290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 89
Target Start/End: Complemental strand, 32589521 - 32589436
Alignment:
| Q |
5 |
tatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||| || || |||||||||||| ||||| ||||||||||| ||||| |||||||||| ||||||||| | ||||||| |
|
|
| T |
32589521 |
tatatgcaggagccggggttcgaaccccggtcactccacttctccacaattaaattgtgtgagctctaaccactaggctacttgac |
32589436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 32594285 - 32594374
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| | || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
32594285 |
atattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
32594374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 4 - 68
Target Start/End: Complemental strand, 34656428 - 34656363
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||| ||| |||||||| ||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
34656428 |
ttatatgcaggggttggggttcgaacctcggacactccacttctccacaattaaattgtgtgagct |
34656363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 68
Target Start/End: Complemental strand, 36666606 - 36666545
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| || |||||||||||||||| | ||||||||||| |||| |||||||||| |
|
|
| T |
36666606 |
tatgcaggggccggggttcgaaccccggacaccccacttctccacaattaattgtgtgagct |
36666545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 44732667 - 44732756
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||| |||| || |||||||||||||||| | ||||||||||| ||||| ||||||| || | ||||||||| ||||||| |
|
|
| T |
44732667 |
atattatatgcaagggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgaactctagccactagactacttgac |
44732756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 46965774 - 46965863
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||| | ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
46965774 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccataattaaattgtgtgagctctagccactaggctacttgac |
46965863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 51050224 - 51050313
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| |||| || |||||||||| |||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
51050224 |
atattatatgcaggggatggggttcgaaccccagacattccacttctccacaatttaattgtgtgagctctagccactaggctacttgac |
51050313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 52
Target Start/End: Complemental strand, 6463069 - 6463021
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccaca |
52 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||| ||||||||||| |
|
|
| T |
6463069 |
ttatatgcaggggccggggttcgaaccccggacactccacttctccaca |
6463021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 23 - 71
Target Start/End: Complemental strand, 7000976 - 7000928
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttca |
71 |
Q |
| |
|
||||||| |||||||| | |||||||||||||||| ||||||||||||| |
|
|
| T |
7000976 |
ttcgaactccggacaccccacttctccacatttaattgtgtgagcttca |
7000928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 23 - 91
Target Start/End: Original strand, 11860098 - 11860166
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||| |||||||| | | ||||||||| ||| ||||| |
|
|
| T |
11860098 |
ttcgaaccccggacaccccacttctccacatttaattgtgtgaggtccggccactagactactagacaa |
11860166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 16313742 - 16313654
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttga |
88 |
Q |
| |
|
|||||||||||||| || ||| | |||| ||||||||||| ||||||||||| ||||| |||| ||||| | ||||||||| |||||| |
|
|
| T |
16313742 |
atattatatgcaggagccggagtacgaatcccggacactccacttctccacaattaaattgtgggagctctagccactagactacttga |
16313654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 23233985 - 23234053
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacattta-aatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||| | ||||||||||||||| |||||||||||| |
|
|
| T |
23233985 |
atattatatgcaggggtcggggttcgaaccccagacaccctacttctccacatttataatgtgtgagct |
23234053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 27234021 - 27234089
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||| || |||||| |||| |||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
27234021 |
atattatatgcaggggccggggttcgaatcccgaacactccacttctccacaattaaattgtgtgagct |
27234089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 34058248 - 34058316
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || | |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
34058248 |
atattatatgcaggagccgaggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
34058316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 36860632 - 36860700
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagct |
68 |
Q |
| |
|
||||||||||||| ||| || | |||||||||||||| | |||||||||||||| ||||||||||||| |
|
|
| T |
36860632 |
atattatatgcagaggccggggtccgaaccccggacaccccacttctccacatttaaaatgtgtgagct |
36860700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 79
Target Start/End: Complemental strand, 45416208 - 45416136
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||||||| || |||||| ||||||||| | |||||||||||||||| ||||||| || ||||||||| |
|
|
| T |
45416208 |
tatgcaggggccggggttcgaatcccggacaccccacttctccacatttaattgtgtgaactctaaccactag |
45416136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 47930707 - 47930619
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttga |
88 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||| || | |||||| |||| ||||| |||||||||| ||||||||| | |||||| |
|
|
| T |
47930707 |
atattatatgcaggggctggggttcgaacctcggataccccacttcttcacaattaaattgtgtgagctctaaccactaggctacttga |
47930619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 50824446 - 50824378
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||| ||| || |||| ||||| |||||||||| |
|
|
| T |
50824446 |
atattatatgcaggagctggggttcgaaccccggacactccactccttcacaattaaattgtgtgagct |
50824378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 4553582 - 4553491
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||||||| |||||| | ||||||| ||||||||||| ||||| |||||||||| |||||||||| ||||||||| |
|
|
| T |
4553582 |
atattatatgcaggggctgaggttcgaatctcggacacctcacttctccacaattaaattgtgtgagctctaaccactagattacttgacaa |
4553491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 4 - 59
Target Start/End: Complemental strand, 6712142 - 6712087
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
|||||||||||||| || ||| |||||||||||||| ||||||||||| |||||| |
|
|
| T |
6712142 |
ttatatgcaggggccggggttcaaaccccggacactctacttctccacaattaaat |
6712087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 8984541 - 8984451
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || ||||||||| |||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
8984541 |
atattatatgcaggagccggggttcgaaccc-ggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
8984451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 15390254 - 15390345
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||| ||||||||| ||| ||||||||| |||||||| |||||||||| |||||| |||||||| | | ||||||| | ||||||||| |
|
|
| T |
15390254 |
atattagatgcaggggttgggattcgaaccctggacactccacttctccacaatttaattgtgtgagttctagccactaggctacttgacaa |
15390345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 18551669 - 18551590
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||||||||||||| || || |||||||| |||||| ||||||||||| ||||| |||| ||||| ||||||||| |
|
|
| T |
18551669 |
atattatatgcaggggccggggtttgaaccccgaacactccacttctccacaattaaattgtgcgagctctaaccactag |
18551590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 21401469 - 21401378
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat-gtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||||| | |||||||| || |||| ||||||||||| |||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
21401469 |
atattatatgcaggggccgcggttcgaacctcgaacaccacacttctccacaattaaattgtgtgagctttagccactagacaacttgacaa |
21401378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 23 - 69
Target Start/End: Original strand, 30360468 - 30360515
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagctt |
69 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||| ||||||||||| |
|
|
| T |
30360468 |
ttcgaaccccggacactccacttctccacagttaaattgtgtgagctt |
30360515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 33207239 - 33207290
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccaca |
52 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| | ||||||||||| |
|
|
| T |
33207239 |
atattatatgcaggggccggggttcgaaccccggacaccccacttctccaca |
33207290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 35283535 - 35283626
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||| ||| || ||||||||| | |||||| |||||||||| |||||| |||||||||| |||||||| || |||| |||| |
|
|
| T |
35283535 |
atattatatgcagaggccggggttcgaaccctgaacactccacttctccacaatttaattgtgtgagctctaaccactaaactacttaacaa |
35283626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 4 - 59
Target Start/End: Complemental strand, 39347012 - 39346957
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
||||||||||| || || |||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
39347012 |
ttatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaat |
39346957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 40211561 - 40211470
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| | || ||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
40211561 |
atattatatgcaggagtcggggttcgaaccccggacacttcacttctccacaattaaattgtgtgagctatagccactaggctacttgacaa |
40211470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 23 - 89
Target Start/End: Complemental strand, 40519557 - 40519490
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
40519557 |
ttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
40519490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 42490446 - 42490367
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||| | ||||||||||| ||||| ||||||| || ||||||||| |
|
|
| T |
42490446 |
atattatatgcaggggtcggggttcgaaccccggacaccccacttctccacaattaaattgtgtgaactctaaccactag |
42490367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 50899546 - 50899495
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccaca |
52 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| |
|
|
| T |
50899546 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccaca |
50899495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 78
Target Start/End: Complemental strand, 4865854 - 4865780
Alignment:
| Q |
5 |
tatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaa-atgtgtgagcttcaaccacta |
78 |
Q |
| |
|
|||||| ||||| ||| ||||||||||| |||||| |||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
4865854 |
tatatgtaggggtcggagttcgaaccccgaacactccacttcttcacatttaatatatgtgagctacaaccacta |
4865780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 8865888 - 8865954
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgag |
66 |
Q |
| |
|
|||||||||||||||| || ||||||||| |||||||| |||||||||| |||||| |||||||| |
|
|
| T |
8865888 |
atattatatgcaggggtcgggattcgaaccctggacactccacttctccacaatttaattgtgtgag |
8865954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 34 - 68
Target Start/End: Complemental strand, 12182017 - 12181983
Alignment:
| Q |
34 |
gacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
12182017 |
gacactcaacttctccacatttaattgtgtgagct |
12181983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 91
Target Start/End: Original strand, 13152973 - 13153035
Alignment:
| Q |
29 |
ccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| || | ||||||||| ||||||||| |
|
|
| T |
13152973 |
ccccggacacctcacttctccacatttaaatgtgtgaactctagccactagacaacttgacaa |
13153035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 68
Target Start/End: Original strand, 18534057 - 18534103
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
18534057 |
ttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
18534103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 79
Target Start/End: Original strand, 24499783 - 24499837
Alignment:
| Q |
25 |
cgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||| | |||||||||||||||| |||||||| || | ||||||| |
|
|
| T |
24499783 |
cgaaccccggacaccctacttctccacatttaattgtgtgagatttagccactag |
24499837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 65
Target Start/End: Complemental strand, 24910492 - 24910450
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtga |
65 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||| ||||||| |
|
|
| T |
24910492 |
ttcgaaccccggacactccacttctccatatttaattgtgtga |
24910450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 40520317 - 40520387
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttc |
70 |
Q |
| |
|
||||||||||||||| || | || ||||||||||||| | |||||||||||||| |||||| |||||||| |
|
|
| T |
40520317 |
atattatatgcagggattgtagtttgaaccccggacaccctacttctccacatttaaaatgtatgagcttc |
40520387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 43021658 - 43021568
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||| |||||||||| || |||||||| ||||||| | |||||||||||||||| ||||||||| | ||||||||| | ||||||| |
|
|
| T |
43021658 |
atattttatgcaggggtcggggttcgaacctcggacaccccacttctccacatttaatcgtgtgagctgtagccactagactatttgacaa |
43021568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 89
Target Start/End: Complemental strand, 45517301 - 45517215
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||| ||||||| || || ||||||||||||||| |||||||||| |||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
45517301 |
ttatatacaggggccgggattggaaccccggacactccacttctccacaatttaattgtgtgagctctagccactaggctacttgac |
45517215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 88
Target Start/End: Original strand, 50746767 - 50746833
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttga |
88 |
Q |
| |
|
|||||||||||||||| | ||||||||||| ||||| |||| ||||| ||||||||||| |||||| |
|
|
| T |
50746767 |
ttcgaaccccggacaccccacttctccacaattaaattgtgcgagctctaaccactagactacttga |
50746833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 68
Target Start/End: Complemental strand, 6893270 - 6893205
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||| |||| |||||| ||||| |||||||||| |
|
|
| T |
6893270 |
ttatatgcaggggccgaggttcgaaccccggacactccacttttccacaattaaattgtgtgagct |
6893205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 23 - 91
Target Start/End: Complemental strand, 10664809 - 10664740
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||| ||| |||||| | ||||||| | ||||||||| |
|
|
| T |
10664809 |
ttcgaaccccggacactccacttctccacaattaaattgtatgagctctagccactaggctacttgacaa |
10664740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 68
Target Start/End: Complemental strand, 10842087 - 10842026
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
|||| |||||||| | |||||| ||||||||||| ||||||||| |||||| ||||| |||| |
|
|
| T |
10842087 |
tatgtaggggctgaagttcgaatcccggacactccacttctccatatttaattgtgtaagct |
10842026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 12502290 - 12502201
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| | || |||||| ||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
12502290 |
atattatatgcaggagtcggggttcgaaacccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
12502201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 68
Target Start/End: Complemental strand, 25036292 - 25036231
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| || ||||||||||| |||| | | |||||||||||||| |||||||||| |
|
|
| T |
25036292 |
tatgcaggggccgggattcgaaccccgaacaccccatttctccacatttaattgtgtgagct |
25036231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 68
Target Start/End: Complemental strand, 25041504 - 25041443
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| || ||||||||||| |||| | | |||||||||||||| |||||||||| |
|
|
| T |
25041504 |
tatgcaggggccgggattcgaaccccgaacaccccatttctccacatttaattgtgtgagct |
25041443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 68
Target Start/End: Complemental strand, 31124668 - 31124607
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| || ||||||| ||||| || | |||||||||||||||| |||||||||| |
|
|
| T |
31124668 |
tatgcaggggccggggttcgaactccggataccccacttctccacatttaattgtgtgagct |
31124607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 33033160 - 33033249
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||||| | || ||||||||| ||||| | | ||||||||| ||||| |||||||||| ||||||||||| ||||||| |
|
|
| T |
33033160 |
atattatatgcagggaccggggttcgaaccctagacaccccatttctccacaattaaaatgtgtgagctctaaccactagactacttgac |
33033249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 30 - 78
Target Start/End: Original strand, 33200102 - 33200151
Alignment:
| Q |
30 |
cccggacactcaacttctccacatttaa-atgtgtgagcttcaaccacta |
78 |
Q |
| |
|
||||||||||| ||||||||||||| || |||||||||||||| |||||| |
|
|
| T |
33200102 |
cccggacactccacttctccacattaaatatgtgtgagcttcagccacta |
33200151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 23 - 68
Target Start/End: Complemental strand, 34562801 - 34562756
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||| | ||||||||| |||||| |||||||||| |
|
|
| T |
34562801 |
ttcgaaccccggacaccccacttctccatatttaattgtgtgagct |
34562756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 1151793 - 1151861
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||| |||| || || |||||||||||||||||| |||||| |||| ||||| |||||||||| |
|
|
| T |
1151793 |
atattatatacaggagccgggattcgaaccccggacactccacttcttcacaattaaattgtgtgagct |
1151861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 4281441 - 4281480
Alignment:
| Q |
26 |
gaaccccggacactcaacttctccacatttaaatgtgtgag |
66 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
4281441 |
gaaccccggacaccca-cttctccacatttaaatgtgtgag |
4281480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 6130069 - 6130001
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| | || ||||||| |||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
6130069 |
atattatatgcaggagtcggggttcgaactccggacactccacttctccacaattaaattgtgtgagct |
6130001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 80
Target Start/End: Original strand, 11344476 - 11344552
Alignment:
| Q |
5 |
tatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaa-atgtgtgagcttcaaccactaga |
80 |
Q |
| |
|
|||||| || ||| ||| ||||||||| |||||| ||||||||||||| || |||||||||||||| |||||||| |
|
|
| T |
11344476 |
tatatgtagaggccggagttcgaaccctggacacctcacttctccacattaaatatgtgtgagcttcagccactaga |
11344552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 80
Target Start/End: Original strand, 11502496 - 11502572
Alignment:
| Q |
5 |
tatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaa-atgtgtgagcttcaaccactaga |
80 |
Q |
| |
|
|||||| || ||| ||| ||||||||| |||||| ||||||||||||| || |||||||||||||| |||||||| |
|
|
| T |
11502496 |
tatatgtagaggccggagttcgaaccctggacacctcacttctccacattaaatatgtgtgagcttcagccactaga |
11502572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 24 - 79
Target Start/End: Original strand, 12613234 - 12613290
Alignment:
| Q |
24 |
tcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||||||||||| | ||||||| |||||| ||||||||||||| ||| |||||| |
|
|
| T |
12613234 |
tcgaaccccggacaccccacttctctacatttaaaatgtgtgagctccaatcactag |
12613290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 67
Target Start/End: Complemental strand, 18893288 - 18893224
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagc |
67 |
Q |
| |
|
|||||||||| ||| || |||||| ||||||||||| ||||||||||| ||||| ||||||||| |
|
|
| T |
18893288 |
ttatatgcagaggccggggttcgaatcccggacactccacttctccacaattaaattgtgtgagc |
18893224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 78
Target Start/End: Original strand, 18911907 - 18911963
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccacta |
78 |
Q |
| |
|
|||||||||||||||| | ||| |||||||||| ||||||||||||| || |||||| |
|
|
| T |
18911907 |
ttcgaaccccggacaccccactcctccacatttaaaatgtgtgagctccagccacta |
18911963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 38
Target Start/End: Original strand, 19793558 - 19793594
Alignment:
| Q |
2 |
tattatatgcaggggctggatttcgaaccccggacac |
38 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
19793558 |
tattatatgcaggggccggaattcgaaccccggacac |
19793594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 27579510 - 27579442
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||| | | ||||||||| ||||| | | |||||||||||| ||||||||||||| |
|
|
| T |
27579510 |
atattatatgcaggggccgaagttcgaaccctagacaccccatttctccacatttaaaatgtgtgagct |
27579442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 91
Target Start/End: Complemental strand, 33218922 - 33218834
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||| ||||| ||| ||||||||||||||||| |||||||||| |||||| ||||| |||| | |||||||| ||||||||| |
|
|
| T |
33218922 |
ttatatgtagggggtggggttcgaaccccggacacttcacttctccacaatttaattgtgtaagctctagtcactagactacttgacaa |
33218834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 33254762 - 33254830
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| | || || ||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
33254762 |
atattatatgcaggagtcggggttggaaccccggacactccacttctccacaattaaattgtgtgagct |
33254830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 33274934 - 33275002
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| | || || ||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
33274934 |
atattatatgcaggagtcggggttggaaccccggacactccacttctccacaattaaattgtgtgagct |
33275002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 33 - 81
Target Start/End: Complemental strand, 34557327 - 34557279
Alignment:
| Q |
33 |
ggacactcaacttctccacatttaaatgtgtgagcttcaaccactagac |
81 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
34557327 |
ggacaccctacttctccacatttaaatgtgtgagctctagccactagac |
34557279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 38
Target Start/End: Original strand, 38021284 - 38021320
Alignment:
| Q |
2 |
tattatatgcaggggctggatttcgaaccccggacac |
38 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
38021284 |
tattatatgcaggggccggagttcgaaccccggacac |
38021320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 79
Target Start/End: Complemental strand, 39670859 - 39670787
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||| ||| ||||||| || |||| | |||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
39670859 |
tatgcaggggttggggttcgaactccagacatcccacttctccacatttaattgtgtgagctctaaccactag |
39670787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 41927032 - 41927088
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
41927032 |
ttcgaatcccggacaccttacttctccacatttaattgtgtgagctctaaccactag |
41927088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 42054367 - 42054435
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||| |||||| || ||||||||| ||||| || |||||||||| |||||| |||||||||| |
|
|
| T |
42054367 |
atattatatgtaggggccggggttcgaaccctggacattccacttctccacaatttaactgtgtgagct |
42054435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 70
Target Start/End: Original strand, 44579939 - 44579987
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacattta-aatgtgtgagcttc |
70 |
Q |
| |
|
|||||||||| ||||| | ||||||||||||||| |||||||||||||| |
|
|
| T |
44579939 |
ttcgaacccctgacaccccacttctccacatttataatgtgtgagcttc |
44579987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 46161159 - 46161091
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || | ||||||||||| |||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
46161159 |
atattatatgcaggagccgatgttcgaaccccgaacactccacttctccacaattaaattgtgtgagct |
46161091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 68
Target Start/End: Complemental strand, 47643014 - 47642950
Alignment:
| Q |
5 |
tatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||| ||| || ||||||||||| |||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
47643014 |
tatatgcagaggccggggttcgaaccccgaacactccacttctccacaattaaattgtgtgagct |
47642950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 48; Significance: 1e-18; HSPs: 103)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 18503516 - 18503425
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||| | |||||||||||||| |||||||||||||| ||||||||| | ||||||||| |
|
|
| T |
18503516 |
atattatatgcaggggctgaggttcgaaccccagacaccccacttctccacatttaaaatgtgtgagctttaaccactaggctacttgacaa |
18503425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 7 - 81
Target Start/End: Complemental strand, 12007824 - 12007751
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagac |
81 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||| |||| |||||||||| |||||||||||| |
|
|
| T |
12007824 |
tatgcaggggctggggttcgaaccccggacactca-cttctccacaattaattgtgtgagctccaaccactagac |
12007751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 3766845 - 3766934
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| ||||||||| | ||||||| |
|
|
| T |
3766845 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactaggctacttgac |
3766934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 5990181 - 5990093
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || ||||| |||||||||||||||| |||||||||| |||||| ||||||||||| | |||||| || ||||||| |
|
|
| T |
5990181 |
atattatatgcaggcgcgggatt-cgaaccccggacactccacttctccacaatttaattgtgtgagctttagccactaaactacttgac |
5990093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 4 - 68
Target Start/End: Complemental strand, 32074428 - 32074363
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
32074428 |
ttatatgcaggggctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
32074363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 27424873 - 27424961
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||||||| || |||||||| |||| |||| |||||||||||||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
27424873 |
atattatatgcaggggccggggttcgaacctcggatactccacttctccacatttaattgtgtgagctctagccactaggctacttgac |
27424961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 1398939 - 1398872
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||| || |||||| ||||||||| | ||||||||||||||| ||||||||||| |
|
|
| T |
1398939 |
atattatatgcaggggccggggttcgaatcccggacaccccacttctccacatttatatgtgtgagct |
1398872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 10226709 - 10226800
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||||||||| ||||| | ||||||| | ||||||||||| ||||| |||||| ||| ||||||||||| ||||||||| |
|
|
| T |
10226709 |
atattatatgcaggggctggagttcgagcttcggacaccccacttctccacaattaaattgtgtgcgctctaaccactagactacttgacaa |
10226800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 15238923 - 15239014
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctcca-catttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||| ||||||||| |||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
15238923 |
atattatatgcaggggccggggttcgaaccccggacactccacttctccataatttaattgtgtgagctctagccactaggctacttgacaa |
15239014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 31026253 - 31026344
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
31026253 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
31026344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 68
Target Start/End: Original strand, 8174153 - 8174218
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
8174153 |
ttatatgcaggagctggggttcgaaccccggacactctacttctccacaattaaattgtgtgagct |
8174218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 12615785 - 12615874
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||| ||| ||||||| |||||||| | |||||||||| ||||| |||||||||| ||||||||||| ||||||| |
|
|
| T |
12615785 |
atattatatgcaggggttgggattcgaactccggacaccccgcttctccacaattaaattgtgtgagctctaaccactagactacttgac |
12615874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 22774080 - 22774141
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| || ||| |||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
22774080 |
tatgcaggggcaggggttcaaaccccggacaccccacttctccacatttaaatgtgtgagct |
22774141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 24061365 - 24061276
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || ||||||||||| |||||| ||||||||||| ||||| |||||||||| | ||||||||| ||||||| |
|
|
| T |
24061365 |
atattatatgcaggagccggggttcgaaccccgaacactccacttctccacaattaaattgtgtgagctctagccactagactacttgac |
24061276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 29617439 - 29617528
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
29617439 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
29617528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 32856953 - 32856864
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||||||||| | |||||||||| ||||||| |||||||||| |||||| | |||||||| | ||||||| | ||||||| |
|
|
| T |
32856953 |
atattatatgcaggggctgaagttcgaaccccagacactccacttctccacaatttaattatgtgagctctagccactagcctacttgac |
32856864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 36174424 - 36174513
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| |||| |||||| ||||| |||||||||| | ||||||||| ||||||| |
|
|
| T |
36174424 |
atattatatgcaggagccggggttcgaaccccggacactccacttttccacaattaaattgtgtgagctctagccactagactacttgac |
36174513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 44616636 - 44616725
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || ||| || ||||||||||| ||||||||||| ||||| |||||||||| ||||||||||| ||||||| |
|
|
| T |
44616636 |
atattatatgcaggagccggggttcaaaacccggacactccacttctccacaattaaattgtgtgagctctaaccactagactacttgac |
44616725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 47437974 - 47438035
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| || ||| |||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
47437974 |
tatgcaggggcaggggttcaaaccccggacactccacttctccacatttaactgtgtgagct |
47438035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 1563775 - 1563687
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttga |
88 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| | ||||||| ||| ||||| |||||||||| ||||||||| | |||||| |
|
|
| T |
1563775 |
atattatatgcaggggccggggttcgaaccccggacaccccacttctctacaattaaattgtgtgagctctaaccactaggctacttga |
1563687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 30388543 - 30388475
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||| || |||||||||| ||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
30388543 |
atattatatgcaggggccggggttcgaaccccagacactccacttctccacaattaaattgtgtgagct |
30388475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 32676978 - 32676910
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
32676978 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
32676910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 34267587 - 34267519
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
34267587 |
atattatatgcaggagctggggttcgaaccccggacacttcacttctccacaattaaattgtgtgagct |
34267519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 4 - 79
Target Start/End: Original strand, 40200754 - 40200829
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||| || ||||||||||| |||||| ||||||||| ||||||| ||||||||||||| ||||||| |
|
|
| T |
40200754 |
ttatatgcaggggccggggttcgaaccccg-acactccacttctccatatttaaaatgtgtgagcttcagccactag |
40200829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 5 - 81
Target Start/End: Complemental strand, 40518921 - 40518845
Alignment:
| Q |
5 |
tatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagac |
81 |
Q |
| |
|
|||||| ||||| ||| ||||||| |||||||| | |||||||||||||||| |||||||||| |||||| ||||| |
|
|
| T |
40518921 |
tatatgtaggggttgggattcgaactccggacaccccacttctccacatttaattgtgtgagctccaaccattagac |
40518845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 23 - 66
Target Start/End: Complemental strand, 7779010 - 7778967
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgag |
66 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
7779010 |
ttcgaaccccggacactccacttctccacatttaattgtgtgag |
7778967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 13730133 - 13730066
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||| || || ||||||||||||||| | ||||||| |||||| |||||||||| |
|
|
| T |
13730133 |
atattatatgcaggggccggggtttgaaccccggacactccatttctccatatttaattgtgtgagct |
13730066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 14204306 - 14204397
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||| ||||||||| |||||||| ||||||||| |||||||||| |||||| |||||| ||| ||||||| || ||||||||| |
|
|
| T |
14204306 |
atattatatgtaggggctggggttcgaacctcggacactccacttctccacaatttaattgtgtgggctctaaccactgaactacttgacaa |
14204397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 25833589 - 25833680
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||||||| |||||||||| || |||| |||||||||| |||||| ||||| |||| | ||||||| | ||||||||| |
|
|
| T |
25833589 |
atattatatgcaggggctggggttcgaaccccagatactccacttctccacaatttaattgtgtaagctctagccactaggctacttgacaa |
25833680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 91
Target Start/End: Complemental strand, 28800051 - 28799965
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa--tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||| || || ||||||| ||||| | ||||||| ||||||||| |||||||||| |||||||||||| ||||||||| |
|
|
| T |
28800051 |
tatgcaggggcaggggtttgaacccctgacaccccacttctctacatttaaaaatgtgtgagctccaaccactagactacttgacaa |
28799965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 23 - 89
Target Start/End: Complemental strand, 31077917 - 31077850
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||||| ||||||| |
|
|
| T |
31077917 |
ttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactagactacttgac |
31077850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 32619384 - 32619475
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||| ||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
32619384 |
atattatatgtaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
32619475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 46534784 - 46534693
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || ||||||||||| |||||| ||||||||||| ||||| |||||||||| | ||| ||||| ||||||||| |
|
|
| T |
46534784 |
atattatatgcaggagcctgagttcgaaccccgaacactccacttctccacaattaaattgtgtgagctctagccattagactacttgacaa |
46534693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 48719833 - 48719924
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || |||||||||| ||||||| |||||||||| |||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
48719833 |
atattatatgcaggagccggggttcgaaccccagacactccacttctccacaatttaattgtgtgagctctagccactaggctacttgacaa |
48719924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 9877303 - 9877245
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| | ||||||||||| |||||| |
|
|
| T |
9877303 |
atattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaat |
9877245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 19753004 - 19752938
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgag |
66 |
Q |
| |
|
||||||||||||||||| || ||||||||| |||||||| |||||||||| |||||| |||||||| |
|
|
| T |
19753004 |
atattatatgcaggggccggggttcgaaccctggacactccacttctccacaatttaattgtgtgag |
19752938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 23102594 - 23102536
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| | ||||||||||| |||||| |
|
|
| T |
23102594 |
atattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaat |
23102536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 23 - 81
Target Start/End: Complemental strand, 45284833 - 45284775
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagac |
81 |
Q |
| |
|
|||||||||||||||| | ||||||| |||||||| |||||||||| ||||||||||| |
|
|
| T |
45284833 |
ttcgaaccccggacaccccacttctcaacatttaattgtgtgagctctaaccactagac |
45284775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 4 - 89
Target Start/End: Original strand, 48119507 - 48119593
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||| |||||||||| |||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
48119507 |
ttatatgcaggggccgaggttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagccactaggctacttgac |
48119593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 9712234 - 9712165
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagctt |
69 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||| | ||||||||||| ||||| ||||||||||| |
|
|
| T |
9712234 |
atattatatgcaggggtcggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctt |
9712165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 4 - 68
Target Start/End: Original strand, 12264091 - 12264156
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| ||| ||||||||| | |||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
12264091 |
ttatatgcaggggccggagttcgaaccctgaacactccacttctccacaattaaattgtgtgagct |
12264156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 12640625 - 12640536
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||| ||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
12640625 |
atattatatgcaggagccggggttcgaaccccagacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
12640536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 13720804 - 13720893
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctcc-acatttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||||||| || ||||||||||| |||||| |||||||| | |||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
13720804 |
atattatatgcaggggccggggttcgaaccccgaacactccacttctccaaaatttaattgtgtgagctctagccactaggctacttgac |
13720893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 15106727 - 15106638
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| | || |||||||||| ||||||| ||||||||||| ||||| ||||||||||| | ||| ||||| ||||||| |
|
|
| T |
15106727 |
atattatatgcaggagtcggggttcgaaccccagacactccacttctccacaattaaattgtgtgagctttagccagtagactacttgac |
15106638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 24781064 - 24781153
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || ||||||||||||| |||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
24781064 |
atattatatgcaggagccggggttcgaaccccggatactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
24781153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 26801765 - 26801676
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| |||||| |||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
26801765 |
atattatatgcaggagccggggttcgaaccccggacactccacttcttcacaattaaattgtgtgagctctagccactaggctacttgac |
26801676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 27788309 - 27788370
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| || |||||||||| ||||| | |||||||||||||||||||| |||||| |
|
|
| T |
27788309 |
tatgcaggggccggggttcgaaccccagacaccccacttctccacatttaaatgtatgagct |
27788370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 27791465 - 27791526
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| || |||||||||| ||||| | |||||||||||||||||||| |||||| |
|
|
| T |
27791465 |
tatgcaggggccggggttcgaaccccagacaccccacttctccacatttaaatgtatgagct |
27791526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 31769548 - 31769459
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| | || |||||||||| ||||||| ||||||||||| ||||| ||||||||||| | ||||||| | ||||||| |
|
|
| T |
31769548 |
atattatatgcaggagtcggggttcgaaccccagacactctacttctccacaattaaattgtgtgagctttagccactaggctacttgac |
31769459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 35645633 - 35645722
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || ||||||||| |||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
35645633 |
atattatatgcaggagccggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
35645722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 35950162 - 35950251
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| | || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
35950162 |
atattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
35950251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 38889529 - 38889440
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||||||||| |||| ||||| ||||||| |||||||||| |||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
38889529 |
atattatatgcaggggctgaggttcgtaccccagacactccacttctccacaatttaattgtgtgagctctatccactaggctacttgac |
38889440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 4 - 68
Target Start/End: Original strand, 46645746 - 46645811
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || |||||||||||||||| | ||| |||||||||| ||||||||||||| |
|
|
| T |
46645746 |
ttatatgcaggggccggggttcgaaccccggacaccccactcctccacatttaaaatgtgtgagct |
46645811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 4 - 68
Target Start/End: Original strand, 48447786 - 48447851
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || |||||||||| ||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
48447786 |
ttatatgcaggggccggggttcgaaccccagacactccacttctccacaattaaattgtgtgagct |
48447851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 91
Target Start/End: Original strand, 49089559 - 49089624
Alignment:
| Q |
26 |
gaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||| | |||||||||||| ||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
49089559 |
gaaccccggacaccccacttctccacatataattgtgtgagctctagccactagactacttgacaa |
49089624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 79
Target Start/End: Original strand, 13702062 - 13702138
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||| || ||| |||||||||||| | ||| |||||||||| ||||||||||||| || ||||||| |
|
|
| T |
13702062 |
ttatatgcaggggccggggttcaaaccccggacaccccactcctccacatttaaaatgtgtgagctccagccactag |
13702138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 15694584 - 15694647
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtg |
64 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||| |||||| ||| |||||| |||||| |
|
|
| T |
15694584 |
atattatatgcaggggctgggttt-gaaccccggacactccacttcttcacaatttaattgtgtg |
15694647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 15701564 - 15701627
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtg |
64 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||| |||||| ||| |||||| |||||| |
|
|
| T |
15701564 |
atattatatgcaggggctgggttt-gaaccccggacactccacttcttcacaatttaattgtgtg |
15701627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 21875664 - 21875596
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||| |||| |||| | ||||| |||||||||| |
|
|
| T |
21875664 |
atattatatgcaggggtcggagttcgaaccccggacactccacttttccataattaaattgtgtgagct |
21875596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 24880488 - 24880420
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || ||||||||||| |||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
24880488 |
atattatatgcaggagccggggttcgaaccccgaacactccacttctccacaattaaattgtgtgagct |
24880420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 91
Target Start/End: Original strand, 28800161 - 28800212
Alignment:
| Q |
42 |
acttctccacatttaaat--gtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
28800161 |
acttctccacatttaaaaaggtgtgagcttcaaccactagactacttgacaa |
28800212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 31191636 - 31191568
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||| |||||| |||| ||||| |||||||||| |
|
|
| T |
31191636 |
atattatatgcagggatcggagttcgaaccccggacactccacttctgcacaattaaattgtgtgagct |
31191568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 91
Target Start/End: Complemental strand, 35835732 - 35835644
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||| |||| || |||||||| | ||||||| ||||||||||| ||||| |||||||||| || ||||||| | ||||||||| |
|
|
| T |
35835732 |
ttatatgcaagggccggggttcgaacctcagacactccacttctccacaattaaattgtgtgagctccagccactaggctacttgacaa |
35835644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 36114336 - 36114288
Alignment:
| Q |
42 |
acttctccacatttaaatgtgtgagcttcaaccactagacgacttgaca |
90 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||| |||||||| |
|
|
| T |
36114336 |
acttctccacatttaaatgtgtgagctctaaccattagactacttgaca |
36114288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 36391940 - 36391872
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| | || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
36391940 |
atattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
36391872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 31 - 79
Target Start/End: Complemental strand, 41331085 - 41331037
Alignment:
| Q |
31 |
ccggacactcaacttctccacatttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||| | |||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
41331085 |
ccggacaccccacttctccacatttaattgtgtgagctttaaccactag |
41331037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 43633126 - 43633058
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || |||||| ||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
43633126 |
atattatatgcaggagccggggttcgaatcccggacactccacttctccacaattaaattgtgtgagct |
43633058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 47641079 - 47641147
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| ||||||| |||||||||| |||||| ||||| |||| |
|
|
| T |
47641079 |
atattatatgtaggggctggggttcgaaccccagacactccacttctccacaatttaattgtgtaagct |
47641147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 10659 - 10568
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||| || ||||||| ||| |||||| |||||||||| |||||| |||||||| | ||||| ||||| ||||||||| |
|
|
| T |
10659 |
atattatatgcaggggatgtgattcgaactccgaacactccacttctccacaatttaattgtgtgagttctaaccattagactacttgacaa |
10568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 23 - 89
Target Start/End: Original strand, 3062830 - 3062897
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
3062830 |
ttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
3062897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 4 - 59
Target Start/End: Original strand, 3158885 - 3158940
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
|||||| ||||||||||| |||||||||| ||||||| |||| |||||| |||||| |
|
|
| T |
3158885 |
ttatatacaggggctggagttcgaaccccagacactctacttttccacaattaaat |
3158940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 4960818 - 4960909
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| | || |||||||||| ||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
4960818 |
atattatatgcaggagtcggggttcgaacccctgacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
4960909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 7401423 - 7401332
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| ||| || ||||| ||||||||| ||||||||||| ||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
7401423 |
atattatatgcaggaattggggtttgaacctcggacactccacttctccacaattaaattgtgtgagctctagccactagactacttgacaa |
7401332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 21066920 - 21067010
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggaca-ctcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||| |||||| || ||||||||||||||| |||| ||||||||||||||| |||| ||||| | ||||||| | ||||||||| |
|
|
| T |
21066920 |
atattatatgtaggggccggggttcgaaccccggacatctca-cttctccacatttaattgtgcgagctctagccactaggctacttgacaa |
21067010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 2 - 45
Target Start/End: Original strand, 25818318 - 25818361
Alignment:
| Q |
2 |
tattatatgcaggggctggatttcgaaccccggacactcaactt |
45 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||| |||| |
|
|
| T |
25818318 |
tattatatgcaggggctggagttcgaaccccgaacactccactt |
25818361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 31727827 - 31727749
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||| || | ||| |||||||| ||||||||| |||||||||| |||||| |||||||||| ||||||||| |
|
|
| T |
31727827 |
atattatatgcaaggtc-ggagttcgaaccacggacactccacttctccacaatttaattgtgtgagctcaaaccactag |
31727749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 4 - 59
Target Start/End: Complemental strand, 42548061 - 42548006
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
||||||| ||||||||| |||||||| ||||||||| ||||||||||| |||||| |
|
|
| T |
42548061 |
ttatatgtaggggctggggttcgaacctcggacactctacttctccacaattaaat |
42548006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 34 - 68
Target Start/End: Original strand, 6252146 - 6252180
Alignment:
| Q |
34 |
gacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6252146 |
gacactccacttctccacatttaaatgtgtgagct |
6252180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 68
Target Start/End: Original strand, 26122086 - 26122132
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
26122086 |
ttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
26122132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 30806149 - 30806207
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||| | ||||||||||| |||||| |
|
|
| T |
30806149 |
atattatatgcaggggtcggagttcgaaccccggacatcccacttctccacaattaaat |
30806207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 35612603 - 35612545
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
||||||||||||| || ||| || ||||||||||||||| ||||||||||| |||||| |
|
|
| T |
35612603 |
atattatatgcagaggttggggtttgaaccccggacactccacttctccacaattaaat |
35612545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 43324597 - 43324686
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||| ||||||||||| |||||||| || ||||| || ||||| |||||| ||||||||||||| | ||||||||| ||||||||| |
|
|
| T |
43324597 |
atattaaatgcaggggctaagtttcgaacgcctgacaccca-cttcttcacattaaaatgtgtgagctctagccactagactacttgacaa |
43324686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 48413962 - 48413904
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
|||||||||||||| |||| ||||||| |||||||||| ||||||||||| |||||| |
|
|
| T |
48413962 |
atattatatgcaggagctgagattcgaactccggacactccacttctccacaattaaat |
48413904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 10244925 - 10244836
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||| ||| || || |||||||||||||||| | ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
10244925 |
atattatatgtaggagccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
10244836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 20101688 - 20101631
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa |
58 |
Q |
| |
|
||||||||||||||||| || ||||||| |||||||| | ||||||||| ||||||| |
|
|
| T |
20101688 |
atattatatgcaggggccggggttcgaactccggacaccctacttctccatatttaaa |
20101631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 68
Target Start/End: Complemental strand, 23274844 - 23274783
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| ||| |||||||||||||||| | | || |||||| |||| |||||||||| |
|
|
| T |
23274844 |
tatgcaggggccggagttcgaaccccggacaccccatttttccacaattaattgtgtgagct |
23274783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 23 - 68
Target Start/End: Original strand, 25155597 - 25155642
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||| |||||| | |||||||||||||||| |||||||||| |
|
|
| T |
25155597 |
ttcgaaccctggacaccccacttctccacatttaattgtgtgagct |
25155642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 23 - 91
Target Start/End: Complemental strand, 28424345 - 28424276
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaat-gtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||| || | |||||| |||| |||||| ||||||||| ||||||||||| ||||||||| |
|
|
| T |
28424345 |
ttcgaaccccggaaaccccacttcttcacaattaaattgtgtgagctctaaccactagactacttgacaa |
28424276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 28805334 - 28805423
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||| ||||||||||| || || ||||||||||||| | ||||||||||| ||||| || ||||||| ||||||||||| ||||||| |
|
|
| T |
28805334 |
atatcatatgcaggggtcggggttagaaccccggacaccccacttctccacaattaaattgagtgagctctaaccactagactacttgac |
28805423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 23 - 91
Target Start/End: Complemental strand, 29281356 - 29281287
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||| |||||| ||| ||||||||||| ||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
29281356 |
ttcgaacaccggacgctccacttctccacaattaaattgtgtgagctctagccactagactacttgacaa |
29281287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 68
Target Start/End: Original strand, 32047126 - 32047191
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || |||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
32047126 |
ttatatgcaggggccggggttcgaaccccggacacctcacttctccacaattaaattgtgtgagct |
32047191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 68
Target Start/End: Complemental strand, 35683160 - 35683095
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||| || ||||||| |||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
35683160 |
ttatatgcaggggtcggggttcgaactccggacactccacttctccacaattaaattgtgtgagct |
35683095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 23 - 68
Target Start/End: Original strand, 36932029 - 36932074
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||| | ||||||| |||||||| |||||||||| |
|
|
| T |
36932029 |
ttcgaaccccggacaccccacttctctacatttaattgtgtgagct |
36932074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 42443723 - 42443812
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaa-atgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||| ||||||||||| ||||||||||| |||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
42443723 |
atattatatgcaggagccggggttcgaatcccggacactccacttctccacaattaagttgtgtgagctctagccactaggctacttgac |
42443812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 42798352 - 42798284
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagctt |
69 |
Q |
| |
|
||||||||||| |||||||| ||||||| ||| |||| | |||||||||||||| |||||||||||||| |
|
|
| T |
42798352 |
atattatatgc-ggggctggggttcgaactccgaacacccgacttctccacatttaaaatgtgtgagctt |
42798284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 81
Target Start/End: Complemental strand, 47440842 - 47440765
Alignment:
| Q |
5 |
tatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaa-atgtgtgagcttcaaccactagac |
81 |
Q |
| |
|
|||||||||||| || ||||||||| |||||| | ||||||||||||| || ||||||||||| || ||||||||| |
|
|
| T |
47440842 |
tatatgcaggggtcggggttcgaaccctggacaccccacttctccacattaaatatgtgtgagctccagccactagac |
47440765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 68
Target Start/End: Complemental strand, 48674595 - 48674530
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||| ||| ||| |||||||||||||| ||||||||| | ||||| |||||||||| |
|
|
| T |
48674595 |
ttatatgcaggggttggggttcaaaccccggacactccacttctccataattaaattgtgtgagct |
48674530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 9684656 - 9684743
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| | | |||||||||||| ||| || |||||| |||||||||| ||||||||| |||||||| || ||||||| |
|
|
| T |
9684656 |
atattatatgcaggtgtcgtgtttcgaaccccgaacattccacttcttcacatttaaa-atgtgagctttaaccactaaactacttgac |
9684743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 24 - 79
Target Start/End: Original strand, 11745244 - 11745300
Alignment:
| Q |
24 |
tcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||| | |||||||| ||||||||| |
|
|
| T |
11745244 |
tcgaaccccggacactctacttctccacaattaaattatgtgagctctaaccactag |
11745300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 52
Target Start/End: Complemental strand, 28444115 - 28444067
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccaca |
52 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||| ||||||||||| |
|
|
| T |
28444115 |
ttatatgcaggggccgaggttcgaaccccggacactccacttctccaca |
28444067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 79
Target Start/End: Original strand, 46758279 - 46758355
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||||||||| || ||||||| |||||||| | ||| |||||||||| ||||||||||||| || ||||||| |
|
|
| T |
46758279 |
ttatatgcaggggtcggggttcgaactccggacaccccactcctccacatttaaaatgtgtgagctccagccactag |
46758355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 91
Target Start/End: Original strand, 47463968 - 47464056
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||| ||| |||||||| ||||||| | ||||||||||| ||||| ||||||| || | ||||||| | ||||||||| |
|
|
| T |
47463968 |
ttatatgcaggggttggggttcgaacctcggacaccccacttctccacaattaaattgtgtgatctctatccactaggctacttgacaa |
47464056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 47999814 - 47999882
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||| ||| ||||| |||||| ||||||||||| ||||||||| | ||||| |||||||||| |
|
|
| T |
47999814 |
atattatatgtaggagctggggttcgaatcccggacactccacttctccataattaaattgtgtgagct |
47999882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 131)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 7 - 68
Target Start/End: Complemental strand, 49443453 - 49443392
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| ||| |||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
49443453 |
tatgcaggggccggagttcgaaccccggacaccccacttctccacatttaaatgtgtgagct |
49443392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 22501967 - 22501878
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||| |||||||||| |||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
22501967 |
atattatatgcaggggctggggttcgaaccccagacactccacttctccacaatttaattgtgtgagctctagccactaggctacttgac |
22501878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 7 - 68
Target Start/End: Complemental strand, 46845001 - 46844940
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||| ||| |||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
46845001 |
tatgcaggggtcggagttcgaaccccggacaccctacttctccacatttaaatgtgtgagct |
46844940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 7 - 79
Target Start/End: Original strand, 9685036 - 9685108
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||| |||||| |||| |||||| ||||||||| ||||||||||||||||| || ||||||| |
|
|
| T |
9685036 |
tatgcaggggctggggttcgaatcccgaacactccacttctccatatttaaatgtgtgagctccagccactag |
9685108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 4 - 79
Target Start/End: Complemental strand, 27329965 - 27329889
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||| || |||||||||||||||| | |||||||||||||| ||||||||||||| || ||||||| |
|
|
| T |
27329965 |
ttatatgcaggggccggggttcgaaccccggacaccccacttctccacatttaaaatgtgtgagctccagccactag |
27329889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 4 - 79
Target Start/End: Complemental strand, 44625258 - 44625182
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||| || |||||||||||||||| | |||||||||||||| ||||||| ||||| |||||||||| |
|
|
| T |
44625258 |
ttatatgcaggggccggggttcgaaccccggacaccccacttctccacatttaaaatgtgggagctccaaccactag |
44625182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 4 - 79
Target Start/End: Original strand, 51879132 - 51879208
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||| || |||||||||||||||| | |||||||||||||| ||||||||||||| || ||||||| |
|
|
| T |
51879132 |
ttatatgcaggggccggggttcgaaccccggacaccccacttctccacatttaaaatgtgtgagctccagccactag |
51879208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 3894578 - 3894669
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || ||||||| |||||||||| ||||||||||| ||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
3894578 |
atattatatgcaggagccggggttcgaactccggacactccacttctccacaattaaattgtgtgagctctagccactagactacttgacaa |
3894669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 17729025 - 17729116
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||| || ||||||||| |||||||| ||||||||||| ||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
17729025 |
atattatatgcaggggtcggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctctagccactagactacttgacaa |
17729116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 19030254 - 19030345
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||| || ||||||||| |||||||| ||||||||||| ||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
19030254 |
atattatatgcaggggtcggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctctagccactagactacttgacaa |
19030345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 23939068 - 23939135
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||||| || ||| |||||||||||||||||| |||||| |||||||| ||||||||||| |
|
|
| T |
23939068 |
atattatatgcagaggttggggttcgaaccccggacactctacttcttcacatttatatgtgtgagct |
23939135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 5 - 91
Target Start/End: Complemental strand, 25884020 - 25883933
Alignment:
| Q |
5 |
tatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||| || |||||||||||||||| | |||||||||||||| ||||||||||||| || ||||||| | ||||||||| |
|
|
| T |
25884020 |
tatatgcaggggtcggggttcgaaccccggacaccccacttctccacatttaaaatgtgtgagctccagccactaggctacttgacaa |
25883933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 53752736 - 53752645
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||||| ||| ||||||||| |||||||| |||||||||| |||||| |||||||| | | ||||||| | ||||||||| |
|
|
| T |
53752736 |
atattatatgcaggggcaggagttcgaaccctggacactccacttctccacaatttaattgtgtgagttctagccactaggctacttgacaa |
53752645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 54769866 - 54769799
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || ||| |||||||| ||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
54769866 |
atattatatgcaggtgccggagttcgaaccacggacaccccacttctccacatttaattgtgtgagct |
54769799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 4 - 89
Target Start/End: Original strand, 4860198 - 4860284
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||| | ||||||||||| ||||| |||||||||| ||||||||||| ||||||| |
|
|
| T |
4860198 |
ttatatgcaggggctgaggttcgaaccccagacaccccacttctccacaattaaattgtgtgagctctaaccactagactacttgac |
4860284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 4 - 89
Target Start/End: Complemental strand, 37488493 - 37488407
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
37488493 |
ttatatgcaggggccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
37488407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 44764762 - 44764821
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| || |||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
44764762 |
tatgcaggggcggg--ttcgaaccccggacactccacttctccacatttaattgtgtgagct |
44764821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 4 - 81
Target Start/End: Complemental strand, 49028976 - 49028898
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactagac |
81 |
Q |
| |
|
|||||||||||| | || ||||||||||| |||||| |||||||||||||| ||||| ||||||| |||||||||||| |
|
|
| T |
49028976 |
ttatatgcagggaccggggttcgaaccccgaacactccacttctccacatttaaaatgcgtgagctccaaccactagac |
49028898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 4139034 - 4139123
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
4139034 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
4139123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 7269989 - 7270078
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| ||||| ||||||| |||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
7269989 |
atattatatgcaggagctggggttcgaactccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
7270078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 10482889 - 10482800
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| ||||| ||||||| |||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
10482889 |
atattatatgcaggagctggggttcgaactccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
10482800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 13638281 - 13638192
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| ||||||| |||||||||| |||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
13638281 |
atattatatgtaggggctggggttcgaaccccagacactccacttctccacaatttaattgtgtgagctatagccactaggctacttgac |
13638192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 18194372 - 18194461
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
18194372 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
18194461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 68
Target Start/End: Complemental strand, 19222616 - 19222555
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| || |||||||||||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
19222616 |
tatgcaggggccggggttcgaaccccggacaccccacttctccacatttaattgtgtgagct |
19222555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 24303430 - 24303491
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| || |||||||||||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
24303430 |
tatgcaggggccggggttcgaaccccggacaccccacttctccacatttaattgtgtgagct |
24303491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 80
Target Start/End: Original strand, 34102103 - 34102182
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt---aaatgtgtgagcttcaaccactaga |
80 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| | |||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
34102103 |
ttatatgcaggggctggggttcgaaccccggacacctcatttctccacatttaaaaaatgtgtgagctccaaccactaga |
34102182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 37800647 - 37800558
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
37800647 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
37800558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 39719969 - 39720058
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| | ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
39719969 |
atattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
39720058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 40933867 - 40933778
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
40933867 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
40933778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 41936443 - 41936354
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| | ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
41936443 |
atattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
41936354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 26 - 91
Target Start/End: Complemental strand, 46817362 - 46817297
Alignment:
| Q |
26 |
gaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||| |||| | ||||||||||||||||||||||||||||| ||||||| || ||| ||||| |
|
|
| T |
46817362 |
gaaccccgaacaccccacttctccacatttaaatgtgtgagcttcgaccactaaactactagacaa |
46817297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 88
Target Start/End: Complemental strand, 48739777 - 48739692
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttga |
88 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||| | ||||||||||| ||||| |||||||||| | ||||||||| |||||| |
|
|
| T |
48739777 |
ttatatgcaggggctggggttcgaaccccagacaccccacttctccacaattaaactgtgtgagctctagccactagactacttga |
48739692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 50496850 - 50496761
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
50496850 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
50496761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 52410277 - 52410188
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||| ||||||| ||||||||||| ||||| |||||||||| | ||||||||| ||||||| |
|
|
| T |
52410277 |
atattatatgcaggagccgggattcgaaccccagacactccacttctccacaattaaattgtgtgagctctagccactagactacttgac |
52410188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 53432773 - 53432684
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| | ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
53432773 |
atattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
53432684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 2390390 - 2390322
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| ||| | |||||||||||||||||||| ||||||||| ||||| |||||||||| |
|
|
| T |
2390390 |
atattatatgcaggagctagggttcgaaccccggacactcaatttctccacaattaaattgtgtgagct |
2390322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 6488158 - 6488226
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||||| | |||||||||| ||||||| |||||||||| |||||| |||||||||| |
|
|
| T |
6488158 |
atattatatgcaggggctagggttcgaaccccagacactccacttctccacaatttaattgtgtgagct |
6488226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 7920354 - 7920422
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||| | || || |||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
7920354 |
atattatatgcaagagccggggttcgaaccccggacactcaacttctccacaattaaattgtgtgagct |
7920422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 10176939 - 10176871
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
10176939 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
10176871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 19996488 - 19996420
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| | ||| |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
19996488 |
atattatatgcaggagttggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
19996420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 31327754 - 31327686
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
31327754 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
31327686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 34102647 - 34102579
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| | ||||||||||| ||||| |||||||||| |
|
|
| T |
34102647 |
atattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaactgtgtgagct |
34102579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 47098766 - 47098834
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||| || |||||||||| ||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
47098766 |
atattatatgcaggggccggggttcgaaccccagacactccacttctccacaattaaattgtgtgagct |
47098834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 50234158 - 50234226
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
50234158 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
50234226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 52974089 - 52974021
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
52974089 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
52974021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 53347326 - 53347258
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||||||| |||| |||||||||| ||||||| |||||||||| |||||| |||||||||| |
|
|
| T |
53347326 |
atattatatgcagggactggggttcgaaccccagacactccacttctccacaatttaattgtgtgagct |
53347258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 25938966 - 25938875
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctcca-catttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||| ||||||||| |||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
25938966 |
atattatatgcaggggctggggttcgaaccccacacactccacttctccataatttaactgtgtgagctctagccactaggctacttgacaa |
25938875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 66
Target Start/End: Original strand, 43280108 - 43280167
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgag |
66 |
Q |
| |
|
||||||||||| || |||||| ||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
43280108 |
tatgcaggggccggggttcgaatcccggacaccccacttctccacatttaaatgtgtgag |
43280167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 45701378 - 45701469
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || ||||||||||||| |||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
45701378 |
atattatatgcaggagccggggttcgaaccccggatactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
45701469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 66
Target Start/End: Complemental strand, 49375711 - 49375652
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgag |
66 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||| |||||||||| | |||||| |
|
|
| T |
49375711 |
tatgcaggggctggcgttcgaaccccggacactccacttcaccacatttaattatgtgag |
49375652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 4 - 89
Target Start/End: Original strand, 4880206 - 4880292
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||| ||||| |||||||||| ||||| | ||||||||||| ||||| |||||||||| ||||||||||| ||||||| |
|
|
| T |
4880206 |
ttatatgcagtggctgaggttcgaaccccagacaccccacttctccacaattaaattgtgtgagctctaaccactagactacttgac |
4880292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 22 - 91
Target Start/End: Original strand, 10349455 - 10349525
Alignment:
| Q |
22 |
tttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||| ||||||||| ||||||||||| ||||| |||||||||| ||||||||| | ||||||||| |
|
|
| T |
10349455 |
tttcgaacctcggacactccacttctccacaattaaattgtgtgagctctaaccactaggctacttgacaa |
10349525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 17608355 - 17608289
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgag |
66 |
Q |
| |
|
||||||||||||||||| || ||||||||| |||||||| |||||||||| |||||| |||||||| |
|
|
| T |
17608355 |
atattatatgcaggggccggggttcgaaccctggacactccacttctccacaatttaattgtgtgag |
17608289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 19999901 - 19999967
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgag |
66 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||| | |||||||| |||||| |||||||| |
|
|
| T |
19999901 |
atattatatgcaggggctggggttcgaaccccagacactctagttctccacaatttaattgtgtgag |
19999967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 49447172 - 49447230
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
49447172 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaat |
49447230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 2522960 - 2523049
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||| | ||||| || ||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
2522960 |
atattatatgcaagagctggggtttgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
2523049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 68
Target Start/End: Complemental strand, 5174040 - 5173979
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| || ||||||||||| |||| | |||||||||||||||| |||||||||| |
|
|
| T |
5174040 |
tatgcaggggcaggggttcgaaccccgaacaccccacttctccacatttaattgtgtgagct |
5173979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 6062852 - 6062795
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa |
58 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
6062852 |
atattatatgcaggggttgagattcgaaccccagacactccacttctccacatttaaa |
6062795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 6919999 - 6919910
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || ||||||||||| |||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
6919999 |
atattatatgcaggagccggggttcgaaccccgaacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
6919910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 23 - 91
Target Start/End: Original strand, 11820060 - 11820129
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||| |||| ||||||||||| ||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
11820060 |
ttcgaaccccggaaactccacttctccacaattaaattgtgtgagctctagccactagactacttgacaa |
11820129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 17218522 - 17218611
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||| |||| || ||| |||||||||||||| |||||||||| |||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
17218522 |
atattatatgcaagggccggggttcaaaccccggacactccacttctccacaatttaattgtgtgagctctagccactaggctacttgac |
17218611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 20489849 - 20489898
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctcca |
50 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||| ||||| ||||| |
|
|
| T |
20489849 |
atattatatgcaggggccggagttcgaaccccggacacccaactactcca |
20489898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 28951756 - 28951817
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| |||||||||| ||||| | || ||| |||||||||||||||||||| |
|
|
| T |
28951756 |
tatgcaggggctggggttcgaaccccagacaccccacatcttcacatttaaatgtgtgagct |
28951817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 72
Target Start/End: Complemental strand, 30442279 - 30442234
Alignment:
| Q |
27 |
aaccccggacactcaacttctccacatttaaatgtgtgagcttcaa |
72 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
30442279 |
aaccccgaacactctacttctccacatttaaatgtatgagcttcaa |
30442234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 31327537 - 31327448
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || ||||||||||||| |||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
31327537 |
atattatatgcaggagccggggttcgaaccccggaaactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
31327448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 4 - 68
Target Start/End: Complemental strand, 32256587 - 32256522
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || |||||||||||||||| | ||||||||||| ||||| |||||||||| |
|
|
| T |
32256587 |
ttatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagct |
32256522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 33706763 - 33706674
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||| | || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
33706763 |
atattatatgcaagagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
33706674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 34898803 - 34898714
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||| | ||||||||||| ||||| |||||||||| | |||||||| ||||||| |
|
|
| T |
34898803 |
atattatatgcaggggctgaggttcgaaccccagacaccccacttctccacaattaaattgtgtgagctctagccactagattacttgac |
34898714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 36666495 - 36666575
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacattta-aatgtgtgagcttcaaccactagac |
81 |
Q |
| |
|
||||||||||||||||| |||| |||||||| ||||| | ||||||||||||||| ||||| |||||| ||||||||||| |
|
|
| T |
36666495 |
atattatatgcaggggcccgatt-cgaaccccagacaccccacttctccacatttataatgtatgagctctaaccactagac |
36666575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 40192190 - 40192255
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgag |
66 |
Q |
| |
|
||||||||||||| || || |||||| ||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
40192190 |
atattatatgcagaggtcggtgttcgaatcccggacactccacttctccacatttaattgtgtgag |
40192255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 40548337 - 40548426
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| | ||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
40548337 |
atattatatgcaggagccggggttcgaaccccggacactccatttctccacaattaaattgtgtgagctctagccactaggctacttgac |
40548426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 4 - 68
Target Start/End: Complemental strand, 42920680 - 42920615
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||| ||| |||||||||| ||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
42920680 |
ttatatgcaggggttggggttcgaaccccagacactccacttctccacaattaaattgtgtgagct |
42920615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 4 - 68
Target Start/End: Complemental strand, 45551842 - 45551777
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||| |||||| || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
45551842 |
ttatatgtaggggccgggattcgaaccccggacactccacttctccacaattaaattgtgtgagct |
45551777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 4 - 68
Target Start/End: Original strand, 50659627 - 50659692
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||| ||||||| ||| ||||| |||||||||| |
|
|
| T |
50659627 |
ttatatgcaggggccggggttcgaaccccggacactccacttctcgacaattaaattgtgtgagct |
50659692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 5636835 - 5636767
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || ||||||||| |||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
5636835 |
atattatatgcaggagccggggttcgaaccctggacactcgacttctccacaattaaattgtgtgagct |
5636767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 9176622 - 9176554
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||| | || || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
9176622 |
atattatatgcaagagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
9176554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 2 - 38
Target Start/End: Original strand, 14417900 - 14417936
Alignment:
| Q |
2 |
tattatatgcaggggctggatttcgaaccccggacac |
38 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14417900 |
tattatatgcaggggctggagttcgaaccccggacac |
14417936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 15975186 - 15975274
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttga |
88 |
Q |
| |
|
|||||||||||||| || || |||||||| ||||||||| |||||| |||| ||||| |||||||||| ||||||||| | |||||| |
|
|
| T |
15975186 |
atattatatgcaggagccggggttcgaacctcggacactccacttcttcacaattaaattgtgtgagctctaaccactaggctacttga |
15975274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 28689708 - 28689640
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| | || |||||||||||||||||| |||||||||| |||||| |||||||||| |
|
|
| T |
28689708 |
atattatatgcaggagtcggggttcgaaccccggacactccacttctccacaatttaattgtgtgagct |
28689640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 31586981 - 31587049
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||| ||| |||||| ||||||||| | ||||||||||| ||||| |||||||||| |
|
|
| T |
31586981 |
atattatatgcaggggtcggagttcgaatcccggacaccccacttctccacaattaaattgtgtgagct |
31587049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 32401546 - 32401602
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||||| | || ||||||||||||| |||||||||| || ||||||| |
|
|
| T |
32401546 |
ttcgaaccccggacaccccacatctccacatttaattgtgtgagctccagccactag |
32401602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 79
Target Start/End: Original strand, 38949714 - 38949786
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||||||| || ||||||||||| |||| | |||||||||||||||| ||||||||| || ||||||| |
|
|
| T |
38949714 |
tatgcaggggccggggttcgaaccccgaacaccccacttctccacatttaatagtgtgagctccagccactag |
38949786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 46754562 - 46754630
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| | ||||||||| ||||| |||||||||| |
|
|
| T |
46754562 |
atattatatgcaggggtcggatttcgaaccccggacaccttatttctccacagttaaattgtgtgagct |
46754630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 79
Target Start/End: Original strand, 46767380 - 46767456
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| | |||||||||||||| ||||||||||||| || ||||||| |
|
|
| T |
46767380 |
ttatatgcaggggctgaggttcaaaccccggacatcccacttctccacatttaaaatgtgtgagctccagccactag |
46767456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 71
Target Start/End: Original strand, 49284862 - 49284926
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttca |
71 |
Q |
| |
|
||||||||| | ||| ||||||||| ||| || | |||||||||||||||| ||||||||||||| |
|
|
| T |
49284862 |
tatgcagggacgggagttcgaaccctggaaaccccacttctccacatttaattgtgtgagcttca |
49284926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 53577989 - 53578057
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||| | || || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
53577989 |
atattatatgcaagagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
53578057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 2007119 - 2007028
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| | || || ||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
2007119 |
atattatatgcaggagtcggggtttgaaccccggacactccacttctccacaattaaattgtgtgagctctatccactaggctacttgacaa |
2007028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 4640516 - 4640425
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| ||||| |||||||| || |||||| |||||| |||| ||||| |||||||||| || |||||| | ||||||||| |
|
|
| T |
4640516 |
atattatatgcaggagctggggttcgaacctcgaacactccacttcttcacaattaaattgtgtgagctctaatcactaggctacttgacaa |
4640425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 27 - 77
Target Start/End: Original strand, 14795171 - 14795222
Alignment:
| Q |
27 |
aaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccact |
77 |
Q |
| |
|
|||||||||||| | |||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
14795171 |
aaccccggacaccccacttctccacatttaaaatgtgtgagctccaaccact |
14795222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 23 - 89
Target Start/End: Complemental strand, 33606954 - 33606887
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
33606954 |
ttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagccactaggctacttgac |
33606887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 38819359 - 38819269
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||| |||| ||| |||||| |||||| |||||||||| |||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
38819359 |
atattatatgcagggactggggttctaacccc-aacactccacttctccacaatttaattgtgtgagctctagccactagactacttgacaa |
38819269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 51155128 - 51155037
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||| ||||||||| |||||||| | ||||| | ||||||||||| ||||| |||||||||| ||| ||||| | ||||||||| |
|
|
| T |
51155128 |
atattatatgtaggggctggggttcgaacctccgacaccccacttctccacaattaaattgtgtgagctctaactactaggctacttgacaa |
51155037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 3748638 - 3748549
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggaca-ctcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||| ||| |||||||||| |||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
3748638 |
atattatatgcaggggttggggttcgaaccccggacatctc-acttctccacaatttaattgtgtgagctctagccactaggctacttgac |
3748549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 4200621 - 4200563
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||| ||||||||| |||||| |
|
|
| T |
4200621 |
atattatatgcaggggtcggggttcgaaccccagacactcaatttctccacaattaaat |
4200563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 19550540 - 19550598
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
|||||||||||||| ||| | ||||||||||| |||||| ||||||||||| |||||| |
|
|
| T |
19550540 |
atattatatgcaggagcttgtgttcgaaccccgtacactccacttctccacaattaaat |
19550598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 91
Target Start/End: Original strand, 22857456 - 22857518
Alignment:
| Q |
29 |
ccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||| |||| | |||| ||||||||||||||||||||||| ||||| ||||| | ||||||| |
|
|
| T |
22857456 |
ccccgaacaccccacttttccacatttaaatgtgtgagctttaaccaatagactatttgacaa |
22857518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 30555240 - 30555174
Alignment:
| Q |
24 |
tcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
30555240 |
tcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
30555174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 31528994 - 31528936
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
|||||||||||||| | || |||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
31528994 |
atattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaat |
31528936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 42108218 - 42108160
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
||||||||||||| ||| || ||||||||||||||| | | ||||||||||| |||||| |
|
|
| T |
42108218 |
atattatatgcagaggccgggtttcgaaccccggacgccccacttctccacaattaaat |
42108160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 44652018 - 44651928
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || | ||||||||||||| || | ||||||||||||||| |||||||| || | ||||||| | ||||||||| |
|
|
| T |
44652018 |
atattatatgcaggagccgaggttcgaaccccggataccccacttctccacatttatatgtgtgaactctagccactaggctacttgacaa |
44651928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 65
Target Start/End: Complemental strand, 48515399 - 48515357
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtga |
65 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48515399 |
ttcgaaccccggacaccacacttctccacatttaaatgtgtga |
48515357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 4541932 - 4541996
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtga |
65 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| ||||||| |||||||||| |||||| ||||||| |
|
|
| T |
4541932 |
atattatatgcaggggctggggttcg-accccagacactccacttctccacaatttaattgtgtga |
4541996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 14271991 - 14271954
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacac |
38 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
14271991 |
atattatatgcaggggccggagttcgaaccccggacac |
14271954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 68
Target Start/End: Complemental strand, 33225381 - 33225316
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||| || || |||||||||| ||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
33225381 |
ttatatgcaggagccggggttcgaaccccagacactccacttctccacaattaaattgtgtgagct |
33225316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 39709095 - 39709151
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||||||| |||||| |||||||||||||| ||||||||||||| || ||||||| |
|
|
| T |
39709095 |
ttcgaaccccg-acactccacttctccacatttaaaatgtgtgagctccagccactag |
39709151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 48251606 - 48251695
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || || |||||| |||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
48251606 |
atattatatgcaggagccggggttagaaccctggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
48251695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 53163628 - 53163717
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||| |||||| || |||||||||||||||| | |||||||| || ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
53163628 |
atattatatgtaggggccggggttcgaaccccggacaccccacttctccgcaattaaattgtgtgagctctagccactaggctacttgac |
53163717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 23 - 68
Target Start/End: Original strand, 53203880 - 53203925
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
|||||| ||| ||||| |||||||||||||||||| |||||||||| |
|
|
| T |
53203880 |
ttcgaatcccagacacccaacttctccacatttaattgtgtgagct |
53203925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 79
Target Start/End: Complemental strand, 15085717 - 15085641
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||||||||| || |||||||||||||||| ||||||||| |||| ||||||||||||| || ||||||| |
|
|
| T |
15085717 |
ttatatgcaggggtcggggttcgaaccccggacacctcacttctccatatttaaaatgtgtgagctccagccactag |
15085641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 17472366 - 17472298
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| ||||| |||||||| |||| |||| | ||||||||| ||||| |||||||||| |
|
|
| T |
17472366 |
atattatatgcaggagctgggattcgaacctcggatactccaattctccacaattaaattgtgtgagct |
17472298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 17602712 - 17602644
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||| |||||| | |||||||||||||||| | ||||||||||| ||||| |||||||||| |
|
|
| T |
17602712 |
atattatatgtaggggccgaggttcgaaccccggacaccccacttctccacaattaaattgtgtgagct |
17602644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 59
Target Start/End: Original strand, 19151589 - 19151625
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
19151589 |
ttcgaaccccggacactccacttctccacaattaaat |
19151625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 67
Target Start/End: Complemental strand, 20243854 - 20243790
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagc |
67 |
Q |
| |
|
||||||||||||| ||| |||||||| |||||||| ||||||||||| ||||| ||||||||| |
|
|
| T |
20243854 |
ttatatgcaggggtcggagttcgaaccttggacactccacttctccacaattaaactgtgtgagc |
20243790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 22472350 - 22472282
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||| | || || |||||||||||||||| | ||||||||||| ||||| |||||||||| |
|
|
| T |
22472350 |
atattatatgcaagagccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagct |
22472282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 25279095 - 25279027
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||| |||||| || || ||||||||||||| | ||||||||||| ||||| |||||||||| |
|
|
| T |
25279095 |
atattatatgtaggggccgggatttgaaccccggacaccccacttctccacaattaaattgtgtgagct |
25279027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 79
Target Start/End: Complemental strand, 27453987 - 27453915
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||| ||||| ||||||||| |||||| |||||||||||||| ||||||||||| || ||||||| |
|
|
| T |
27453987 |
tatgcaggagctggggttcgaacccgggacacctttcttctccacatttatatgtgtgagctccagccactag |
27453915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 29098726 - 29098814
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||| | | ||||||| |||||| ||||| || | | ||||||||| ||||||| |
|
|
| T |
29098726 |
atattatatgcaggggtcggggttcgaaccccggacaccccatttctccatatttaattgtgtaagttctagccactagactacttgac |
29098814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 29373485 - 29373417
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||| || |||||||| | ||||| | ||||||||||| ||||| |||||||||| |
|
|
| T |
29373485 |
atattatatgcaggggccggggttcgaacctcagacaccccacttctccacaattaaattgtgtgagct |
29373417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 32144618 - 32144686
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||| | | ||||||||| ||||| |||||||||| |
|
|
| T |
32144618 |
atattatatgcaggagccggggttcgaaccccggacaccccatttctccacaattaaattgtgtgagct |
32144686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 91
Target Start/End: Complemental strand, 32732570 - 32732482
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||| || ||||||| |||||||||| ||||||||| | ||||| ||||||||||| | ||| || || ||||||||| |
|
|
| T |
32732570 |
ttatatgcaggggtcggggttcgaactccggacactccacttctccataattaaattgtgtgagctttagccaataaactacttgacaa |
32732482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 38
Target Start/End: Original strand, 33206789 - 33206825
Alignment:
| Q |
2 |
tattatatgcaggggctggatttcgaaccccggacac |
38 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33206789 |
tattatatgcaggggctggggttcgaaccccggacac |
33206825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 39966110 - 39966042
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||| || |||||||| | ||||||| |||||||||| |||||| |||||||||| |
|
|
| T |
39966110 |
atattatatgcaggggttgaggttcgaacctcagacactccacttctccacaatttaattgtgtgagct |
39966042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 40910216 - 40910148
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacattta-aatgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||||| | |||||||| ||||||| ||||||||||| ||| | |||||||||| |
|
|
| T |
40910216 |
atattatatgcaggggctgaggtccgaaccccagacactccacttctccacaattatattgtgtgagct |
40910148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 91
Target Start/End: Complemental strand, 40963744 - 40963656
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||| || ||||||||||||||| || ||||||||| |||||| |||||||||| | || |||||| ||||||||| |
|
|
| T |
40963744 |
ttatatgcaggggtcggggttcgaaccccggacaatcctcttctccacaatttaattgtgtgagctctagcctctagactacttgacaa |
40963656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 79
Target Start/End: Original strand, 41710624 - 41710696
Alignment:
| Q |
8 |
atgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||| || |||||| ||||||||| |||||||||||||| ||||||||||||| || ||||||| |
|
|
| T |
41710624 |
atgcaggggccggggttcgaatcccggacacctcacttctccacatttaaaatgtgtgagctccagccactag |
41710696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 42268818 - 42268906
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttga |
88 |
Q |
| |
|
||||||||||||||||| || || ||| ||||||||||| |||||||||| |||||| ||| ||||| ||||||||| | |||||| |
|
|
| T |
42268818 |
atattatatgcaggggccagagtttgaatcccggacactccacttctccacaatttaattgtacgagctctaaccactaggctacttga |
42268906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 44 - 88
Target Start/End: Complemental strand, 44407645 - 44407601
Alignment:
| Q |
44 |
ttctccacatttaaatgtgtgagcttcaaccactagacgacttga |
88 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||| ||| |||||| |
|
|
| T |
44407645 |
ttctccacattaaaatgtgtgagcttcagccacttgactacttga |
44407601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 45198757 - 45198825
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||| |||||||| |||||||| | ||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
45198757 |
atattatatgtaggggctgaggttcgaacctcagacactctacttctccacaattaaattgtgtgagct |
45198825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 38
Target Start/End: Original strand, 47191405 - 47191441
Alignment:
| Q |
2 |
tattatatgcaggggctggatttcgaaccccggacac |
38 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
47191405 |
tattatatgcaggggctggagttcgaaccccgaacac |
47191441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 63
Target Start/End: Complemental strand, 49983738 - 49983682
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgt |
63 |
Q |
| |
|
|||||||||| ||| |||||||||||||||| | ||||||||||| |||| ||||| |
|
|
| T |
49983738 |
tatgcaggggttggggttcgaaccccggacaccctacttctccacaattaattgtgt |
49983682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 91
Target Start/End: Original strand, 53906416 - 53906504
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || |||||||||||||| |||| |||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
53906416 |
ttatatgcaggggccggggtttgaaccccggacacttcacttttccacaattaaattgtgtgagctctagccactaggctacttgacaa |
53906504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 9e-17; HSPs: 81)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 9435660 - 9435728
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||| |||||| |||||||||| |
|
|
| T |
9435660 |
atattatatgcaggggctggggttcgaaccccggacactccacttctccacaatttaattgtgtgagct |
9435728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 4 - 91
Target Start/End: Original strand, 22574907 - 22574995
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||| ||| ||||||||||| |||||| ||||||||||| ||||| |||||||||| ||||||||||| ||||||||| |
|
|
| T |
22574907 |
ttatatgcaggggttggggttcgaaccccgcacactccacttctccacaattaaattgtgtgagctctaaccactagactacttgacaa |
22574995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 31104916 - 31104983
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||| ||| |||||| ||||||||| | ||||||||||||| ||||||||||||| |
|
|
| T |
31104916 |
atattatatgcaggggccggagttcgaatcccggacaccccacttctccacattaaaatgtgtgagct |
31104983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 28148769 - 28148680
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || ||||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
28148769 |
atattatatgcaggagccgggtttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
28148680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 31802087 - 31802176
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||||| ||||||| |
|
|
| T |
31802087 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactagactacttgac |
31802176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 4 - 91
Target Start/End: Original strand, 18904302 - 18904390
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||| || |||||||||||||||| | |||||||||||||| ||||||||||||| || ||||||||| || |||||| |
|
|
| T |
18904302 |
ttatatgcaggggtcggggttcgaaccccggacaccccacttctccacatttaaaatgtgtgagctccagccactagactacctgacaa |
18904390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 1435843 - 1435910
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||| || |||||||||||||||| |||||||||| |
|
|
| T |
1435843 |
atattatatgcaggggccagggttcgaaccccggacattccacttctccacatttaattgtgtgagct |
1435910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 32611590 - 32611499
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
32611590 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
32611499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 5694948 - 5695038
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||| ||| || ||||| ||||||| | ||||||||||||| ||||||||||||| || ||| ||||| | ||||||| |
|
|
| T |
5694948 |
atattatatgcaggggtaggagtttgaacctcggacaccccacttctccacattaaaatgtgtgagctccagccattagactaattgacaa |
5695038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 6210088 - 6210154
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgag |
66 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||| |||||||||| |||||| |||||||| |
|
|
| T |
6210088 |
atattatatgcaggggctggggttcgaaccccagacactccacttctccacaatttaattgtgtgag |
6210154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 4 - 89
Target Start/End: Original strand, 8297664 - 8297750
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || |||||||||||||||| | ||||||||||| ||||| |||||||||| ||||||||| | ||||||| |
|
|
| T |
8297664 |
ttatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctaaccactaggccacttgac |
8297750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 32412349 - 32412279
Alignment:
| Q |
1 |
atattatatgcagggg-ctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagctt |
69 |
Q |
| |
|
|||||||||||||||| ||||| |||||| ||||||||||| ||||||||||| ||||| ||||||||||| |
|
|
| T |
32412349 |
atattatatgcagggggctggagttcgaatcccggacactccacttctccacaattaaattgtgtgagctt |
32412279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 3795810 - 3795721
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||||||| |||||||| | ||||||| |||||||||| |||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
3795810 |
atattatatgcaggggctggggttcgaacctcagacactccacttctccacaatttaattgtgtgagctctagccactaggctacttgac |
3795721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 19953864 - 19953775
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
19953864 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
19953775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 24319053 - 24319114
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| || |||||||||||||||||| ||||||||||| |||| |||||||||| |
|
|
| T |
24319053 |
tatgcaggggccggggttcgaaccccggacactccacttctccacaattaattgtgtgagct |
24319114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 32813686 - 32813605
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagac |
81 |
Q |
| |
|
||||||||||||||||| || ||||||||||||| |||| |||||| |||| ||||| |||||||||| || ||||||||| |
|
|
| T |
32813686 |
atattatatgcaggggccggggttcgaaccccggatactccacttcttcacaattaaattgtgtgagctacagccactagac |
32813605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 4 - 91
Target Start/End: Original strand, 216243 - 216331
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||| |||| |||||||| ||||||| | ||||||||||| ||||| |||||||||| ||||||||| | ||||||||| |
|
|
| T |
216243 |
ttatatgcagggtctggggttcgaacctcggacaccccacttctccacaattaaattgtgtgagctctaaccactaggctacttgacaa |
216331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 4 - 91
Target Start/End: Original strand, 389370 - 389458
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||| |||| |||||| ||||| ||| |||||| |||||||||| ||||||||| |
|
|
| T |
389370 |
ttatatgcaggggtcggagttcgaaccccggacactccacttatccacaattaaattgtatgagctctaaccactagattacttgacaa |
389458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 2426098 - 2426166
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||||||||||| |||||||||| |||||| |||||||||| |
|
|
| T |
2426098 |
atattatatgcaagggttggggttcgaaccccggacactccacttctccacaatttaattgtgtgagct |
2426166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 4 - 91
Target Start/End: Original strand, 10517236 - 10517324
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||| || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
10517236 |
ttatatgcaggggtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
10517324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 16913936 - 16913848
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||| | ||||||||||| | |||||| |||| ||||||||| | ||||||| |
|
|
| T |
16913936 |
atattatatgcaggggtcggggttcgaaccccggacactccatttctccacattcatatgtgttagctctaaccactaggctacttgac |
16913848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 17441875 - 17441807
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
17441875 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
17441807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 19374876 - 19374788
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| |||||| ||||||||| |||||| |||| ||||| | ||||||| | ||||||| |
|
|
| T |
19374876 |
atattatatgcaggggttggggttcgaaccccgaacactccacttctccaaatttaattgtgagagctgtagccactaggctacttgac |
19374788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 32166403 - 32166471
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||| || || ||||||||||||||| |||||||||| |||||| |||||||||| |
|
|
| T |
32166403 |
atattatatgcaggggccgggatttgaaccccggacactccacttctccacaatttaattgtgtgagct |
32166471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 743597 - 743688
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||| ||||||| || || |||||||||||||||||| ||||||||||| ||||| |||| ||||| | ||||||||| ||||||||| |
|
|
| T |
743597 |
atattagatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgcgagctctagccactagactacttgacaa |
743688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 7545363 - 7545454
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||||| | ||||||||||| |||| | ||||||||||| ||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
7545363 |
atattatatgcaggggccagggttcgaaccccgaacaccccacttctccacaattaaattgtgtgagctctagccactagactacttgacaa |
7545454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 22997370 - 22997461
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||| ||||| || |||||||||||||||| | ||||||||||| ||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
22997370 |
atattatatgtaggggtcggggttcgaaccccggacaccctacttctccacaattaaattgtgtgagctctagccactagactacttgacaa |
22997461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 23791031 - 23790940
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||| ||||| || |||||||||||||||| | ||||||||||| ||||| |||||||||| | ||||||||| ||||||||| |
|
|
| T |
23791031 |
atattatatgtaggggtcggggttcgaaccccggacaccctacttctccacaattaaattgtgtgagctctagccactagactacttgacaa |
23790940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 27218918 - 27219009
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||| ||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
27218918 |
atattatatgtaggagccgggattcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
27219009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 24 - 79
Target Start/End: Complemental strand, 29646561 - 29646506
Alignment:
| Q |
24 |
tcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||||||||||| | |||||||||||||||| |||||||||| || ||||||| |
|
|
| T |
29646561 |
tcgaaccccggacaccccacttctccacatttaattgtgtgagctccagccactag |
29646506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 33573851 - 33573942
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||| || || ||||||||| |||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
33573851 |
atattatatgcaggagccggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
33573942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 5 - 68
Target Start/End: Original strand, 2251876 - 2251941
Alignment:
| Q |
5 |
tatatgcaggggctggatttcgaaccccggacactcaacttctccacattt--aaatgtgtgagct |
68 |
Q |
| |
|
||||||||||||| || |||||||||||||||| | |||||||||||||| ||||||||||||| |
|
|
| T |
2251876 |
tatatgcaggggccggggttcgaaccccggacaccccacttctccacatttaaaaatgtgtgagct |
2251941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 3299003 - 3298913
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||| ||||||||||| ||| |||||||| || ||| | ||||||||| ||||||||||||||||| ||||||| ||| ||||||||| |
|
|
| T |
3299003 |
atataatatgcaggggtcggaattcgaacctcgaacatcccacttctccatatttaaatgtgtgagctctaaccacttgactacttgacaa |
3298913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 23 - 81
Target Start/End: Complemental strand, 9689317 - 9689259
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagac |
81 |
Q |
| |
|
||||||||| |||||| | ||| ||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
9689317 |
ttcgaaccctggacaccccactcctccatatttaaatgtgtgagcttcaaccattagac |
9689259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 10934633 - 10934691
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
10934633 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaat |
10934691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 15963979 - 15963913
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgag |
66 |
Q |
| |
|
||||| |||||||||||||| ||||||||| |||||||| |||||||||| |||||| |||||||| |
|
|
| T |
15963979 |
atattttatgcaggggctggggttcgaaccctggacactccacttctccacaatttaattgtgtgag |
15963913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 29284300 - 29284358
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||||||| | ||||||||||| |||||| |
|
|
| T |
29284300 |
atattatatgaaggggccggagttcgaaccccggacaccccacttctccacaattaaat |
29284358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 4 - 81
Target Start/End: Complemental strand, 32142069 - 32141991
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactagac |
81 |
Q |
| |
|
||||||| ||||||||| |||||||||| ||||| | |||| ||||||||| ||||||||||||| || ||||||||| |
|
|
| T |
32142069 |
ttatatgtaggggctggggttcgaaccccagacaccccacttttccacatttaaaatgtgtgagctccagccactagac |
32141991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 89
Target Start/End: Original strand, 3640552 - 3640637
Alignment:
| Q |
5 |
tatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||| |||| || |||||||| ||||||||| |||||||||| |||||| |||||||||| | ||||||||| ||||||| |
|
|
| T |
3640552 |
tatatgcaagggccggggttcgaacctcggacactccacttctccacaatttaattgtgtgagctctagccactagactacttgac |
3640637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 7207878 - 7207967
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| | ||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
7207878 |
atattatatgcaggagccggggttcgaaccccggacactccatttctccacaattaaattgtgtgagctctagccactaggctacttgac |
7207967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 89
Target Start/End: Complemental strand, 19618758 - 19618673
Alignment:
| Q |
5 |
tatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||| |||||||||| |||||||||||||||| | ||||||||||| ||||| ||| |||||| ||||||||| | ||||||| |
|
|
| T |
19618758 |
tatatacaggggctggggttcgaaccccggacaccccacttctccacaattaaattgtatgagctcgaaccactaggctacttgac |
19618673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 4 - 57
Target Start/End: Original strand, 27667197 - 27667250
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaa |
57 |
Q |
| |
|
|||||||||||||| || |||||||||||||||| | |||||||||||||||| |
|
|
| T |
27667197 |
ttatatgcaggggccggggttcgaaccccggacaccccacttctccacatttaa |
27667250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 492936 - 493004
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||| || ||||||||| |||||| | ||||||||||| ||||| |||||||||| |
|
|
| T |
492936 |
atattatatgcaggggccggggttcgaaccctggacaccccacttctccacaattaaattgtgtgagct |
493004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 7418312 - 7418380
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctcca-catttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||||||||| || ||||||||| |||||||| ||||||||| |||||| |||||||||| |
|
|
| T |
7418312 |
atattatatgcaggggcctgagttcgaaccctggacactccacttctccataatttaattgtgtgagct |
7418380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 8439709 - 8439777
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||| || |||||| || ||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
8439709 |
atattatatgcaggggtcgggattcgaatcctggacactcaacttctccacaatttaattgtgtgagct |
8439777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 13158745 - 13158677
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||| | |||| |||||||||||||||| | ||||||||||| ||||| |||||||||| |
|
|
| T |
13158745 |
atattatatgcagagactggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagct |
13158677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 13163601 - 13163533
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||||||| | |||| |||||||||||||||| | ||||||||||| ||||| |||||||||| |
|
|
| T |
13163601 |
atattatatgcagagactggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagct |
13163533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 79
Target Start/End: Original strand, 32616421 - 32616497
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||| | ||||||| ||||| ||||||||||||| || ||||||| |
|
|
| T |
32616421 |
ttatatgcaggggctggggttcgaatcccggacaccccacttctctgcatttaaaatgtgtgagctccagccactag |
32616497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 79
Target Start/End: Complemental strand, 32621615 - 32621539
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||| || |||||| ||| ||||| | |||||||||||||| ||||||||||||| || ||||||| |
|
|
| T |
32621615 |
ttatatgcaggggccggggttcgaatcccagacaccccacttctccacatttaaaatgtgtgagctccagccactag |
32621539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 2688615 - 2688556
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacac-tcaacttctccacatttaaat |
59 |
Q |
| |
|
||||||||| ||| ||||||| |||||||||||||||| || ||||||||||| |||||| |
|
|
| T |
2688615 |
atattatatacagaggctggagttcgaaccccggacacttccacttctccacaattaaat |
2688556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 3709893 - 3709972
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||| ||||| | |||||||||||||| ||||||| ||||| || ||||||| |
|
|
| T |
3709893 |
atattatatgcaaggggtggggttcgaaccccagacaccccacttctccacatttaaaatgtgagagctccagccactag |
3709972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 4 - 59
Target Start/End: Complemental strand, 10483569 - 10483514
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
||||||||||||| || |||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
10483569 |
ttatatgcaggggtcggggttcgaaccccggacactccacttctccacaattaaat |
10483514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 78
Target Start/End: Complemental strand, 35038732 - 35038661
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccacta |
78 |
Q |
| |
|
||||||||||| || |||||||||||||||| | | ||||| |||||||| |||| ||||| ||||||||| |
|
|
| T |
35038732 |
tatgcaggggccggggttcgaaccccggacaccccatttctctacatttaattgtgcgagctccaaccacta |
35038661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 30342 - 30276
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgag |
66 |
Q |
| |
|
||||||||||||||||| || ||||||||| |||||||| |||||| ||| |||||| |||||||| |
|
|
| T |
30342 |
atattatatgcaggggccggggttcgaaccctggacactccacttcttcacaatttaattgtgtgag |
30276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 89
Target Start/End: Original strand, 2816927 - 2817013
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||| | ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
2816927 |
ttatatgcaggggctgagattcgaactccggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
2817013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 58
Target Start/End: Original strand, 7177332 - 7177386
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa |
58 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||| | ||||||||||| ||||| |
|
|
| T |
7177332 |
ttatatgcaggggctggggttcgaaccccagacaccccacttctccacaattaaa |
7177386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 7865391 - 7865325
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgag |
66 |
Q |
| |
|
||||||||||||||||| || || |||||| |||||||| |||||||||| |||||| |||||||| |
|
|
| T |
7865391 |
atattatatgcaggggccggggtttgaaccctggacactccacttctccacaatttaattgtgtgag |
7865325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 9372237 - 9372171
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgag |
66 |
Q |
| |
|
|||||||||||||||| || ||||||||| |||||||| |||||||||| |||||| |||||||| |
|
|
| T |
9372237 |
atattatatgcaggggtcggggttcgaaccctggacactccacttctccacaatttaattgtgtgag |
9372171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 92
Target Start/End: Original strand, 26347464 - 26347530
Alignment:
| Q |
27 |
aaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaat |
92 |
Q |
| |
|
|||||| ||||||| |||||||||| |||||| |||||||||| | ||||||||| |||||||||| |
|
|
| T |
26347464 |
aaccccagacactccacttctccacaatttaattgtgtgagctctagccactagactacttgacaat |
26347530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 3794209 - 3794120
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| | || ||||||||||| |||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
3794209 |
atattatatgcaggaggcggggttcgaaccccgcacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
3794120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 4661130 - 4661179
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctcca |
50 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| |||| || ||||||||| |
|
|
| T |
4661130 |
atattatatgcaggggttgggtttcgaaccccagacattccacttctcca |
4661179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 12284155 - 12284244
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| | || ||||||| ||||| |||| ||||||||||| ||||| |||||||||| | ||||||||| ||||||| |
|
|
| T |
12284155 |
atattatatgcaggtgtcggggttcgaactccggaaactccacttctccacaattaaattgtgtgagctctagccactagactacttgac |
12284244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 13116660 - 13116571
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||| |||| || |||||||||||||||| | |||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
13116660 |
atattatatgcaagggccggggttcgaaccccggacacccctcttctccacaattaaattgtgtgagctctagccactaggctacttgac |
13116571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 13732846 - 13732934
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||| || | ||| ||| |||||||||||||| ||||||||||| ||||| ||| |||||| ||||||||| | ||||||| |
|
|
| T |
13732846 |
atattatatgcaaggcc-ggagttcaaaccccggacactctacttctccacaattaaattgtatgagctctaaccactaggctacttgac |
13732934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 19892312 - 19892223
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||| ||||| || |||||||||||||||||| |||||||||| |||||| |||| ||||| | ||||||| | ||||||| |
|
|
| T |
19892312 |
atattatatgtaggggtcggggttcgaaccccggacactccacttctccacaatttaattgtgagagctctagccactaggctacttgac |
19892223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 28222897 - 28222985
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||| ||| || ||||||||| |||||||| ||||||||| | ||||| |||||||||| ||||||||| | ||||||| |
|
|
| T |
28222897 |
atattatatgcagaggccggggttcgaaccc-ggacactccacttctccataattaaattgtgtgagctctaaccactaggctacttgac |
28222985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 68
Target Start/End: Original strand, 30704997 - 30705062
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||| |||||| || |||||||||||||||| | ||||||||||| ||||| |||||||||| |
|
|
| T |
30704997 |
ttatatgtaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagct |
30705062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 68
Target Start/End: Original strand, 30916358 - 30916423
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||| |||| ||| ||||||||| |||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
30916358 |
ttatatgcgggggttggggttcgaaccctggacactccacttctccacaattaaattgtgtgagct |
30916423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 68
Target Start/End: Original strand, 31935136 - 31935201
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||||| || |||||||||||||||||| |||||||||| |||||| ||||| |||| |
|
|
| T |
31935136 |
ttatatgcaggggtcggggttcgaaccccggacactccacttctccacaatttaattgtgtaagct |
31935201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 79
Target Start/End: Complemental strand, 32670084 - 32670011
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacattta-aatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||||||| || |||||||||| ||||| | ||||||||| ||||| |||||||||||| ||| |||||| |
|
|
| T |
32670084 |
tatgcaggggcaggggttcgaacccctgacaccctacttctccatatttataatgtgtgagctccaaacactag |
32670011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 27 - 68
Target Start/End: Complemental strand, 34574164 - 34574123
Alignment:
| Q |
27 |
aaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||| |||| | ||||||||||||||||||||||||||| |
|
|
| T |
34574164 |
aaccccgaacaccccacttctccacatttaaatgtgtgagct |
34574123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 91
Target Start/End: Complemental strand, 3012756 - 3012668
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||| | ||| || ||||||||||| | |||||||| |||||| |||||||||| | ||| ||||| ||||||||| |
|
|
| T |
3012756 |
ttatatgcaggggctagggttcaaatcccggacactccatttctccacaatttaattgtgtgagctctagccattagactacttgacaa |
3012668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 68
Target Start/End: Original strand, 3196659 - 3196723
Alignment:
| Q |
5 |
tatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||| | ||| ||||||||||||| |||| ||||||||||| ||||| |||||||||| |
|
|
| T |
3196659 |
tatatgcaggagttggggttcgaaccccggatactccacttctccacaattaaattgtgtgagct |
3196723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 68
Target Start/End: Complemental strand, 6329893 - 6329829
Alignment:
| Q |
5 |
tatatgcaggggctggatttcgaaccccggacactcaacttctccacattt-aaatgtgtgagct |
68 |
Q |
| |
|
|||||| ||||| |||| || |||||||| ||| || |||||||||||||| ||||||||||||| |
|
|
| T |
6329893 |
tatatgtaggggttggagtttgaaccccgtacattctacttctccacatttaaaatgtgtgagct |
6329829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 6 - 86
Target Start/End: Complemental strand, 8131821 - 8131741
Alignment:
| Q |
6 |
atatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactagacgactt |
86 |
Q |
| |
|
|||||||||||| || ||| |||||| |||| ||| ||||||| |||||| ||||||| || |||||||||||| |||| |
|
|
| T |
8131821 |
atatgcaggggccggggttcaaaccccagacatccaatttctccatatttaattgtgtgaactccaaccactagactactt |
8131741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 89
Target Start/End: Complemental strand, 9888536 - 9888472
Alignment:
| Q |
26 |
gaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||| | |||||||| ||||||||| | ||||||| |
|
|
| T |
9888536 |
gaaccccggacactccacttctccacaattaaattatgtgagctctaaccactaggctacttgac |
9888472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 10913115 - 10913047
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctcca-catttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||| ||||||||| |||||| |||||||||| |
|
|
| T |
10913115 |
atattatatgcaggggtcggggttcgaaccccagacactccacttctccataatttaattgtgtgagct |
10913047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 38
Target Start/End: Original strand, 12089129 - 12089165
Alignment:
| Q |
2 |
tattatatgcaggggctggatttcgaaccccggacac |
38 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
12089129 |
tattatatgcaggggccggagttcgaaccccggacac |
12089165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 68
Target Start/End: Complemental strand, 16268167 - 16268104
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || ||||||||||||| |||| ||||||||| | |||||| |||||||| |
|
|
| T |
16268167 |
ttatatgcaggggccggggttcgaaccccggatactccacttctccagaattaaat-tgtgagct |
16268104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 28030898 - 28030962
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccaca-tttaaatgtgtg |
64 |
Q |
| |
|
||||||||||||||||| | ||||||||| |||||||| ||||||||||| ||||| |||||| |
|
|
| T |
28030898 |
atattatatgcaggggccagggttcgaaccctggacactccacttctccacagtttaattgtgtg |
28030962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 32050001 - 32049933
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || ||||||| ||| |||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
32050001 |
atattatatgcaggagccggggttcgaactccgaacactccacttctccacaattaaattgtgtgagct |
32049933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0246 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0246
Description:
Target: scaffold0246; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 24420 - 24481
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| || |||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
24420 |
tatgcaggggccggggttcgaaccccggacactccacttcttcacatttaaatgtgtgagct |
24481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 17654 - 17743
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
17654 |
atattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
17743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 59817 - 59906
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||||| ||||||| |
|
|
| T |
59817 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactagactacttgac |
59906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 68
Target Start/End: Complemental strand, 28851 - 28790
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| || |||||||||||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
28851 |
tatgcaggggccggggttcgaaccccggacaccccacttctccacatttaattgtgtgagct |
28790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 1762 - 1704
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
|||||||||| | ||| ||| |||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
1762 |
atattatatgtaagggttggggttcgaaccccggacactccacttctccacaattaaat |
1704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 10862 - 10773
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| | ||||||||||| ||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
10862 |
atattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
10773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0608 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0608
Description:
Target: scaffold0608; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 9000 - 9068
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || ||| ||||||||||||| |||| ||||||||||| ||||| |||||||||| |
|
|
| T |
9000 |
atattatatgcaggagccggagttcgaaccccggatactccacttctccacaattaaattgtgtgagct |
9068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 11156 - 11088
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
11156 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
11088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 21484 - 21416
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
21484 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
21416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 23 - 79
Target Start/End: Complemental strand, 236371 - 236315
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
|||||||||||||||| | |||| |||||||| |||||||||||||| ||||||||| |
|
|
| T |
236371 |
ttcgaaccccggacaccccacttatccacattaaaatgtgtgagctttaaccactag |
236315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0063 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0063
Description:
Target: scaffold0063; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 56357 - 56448
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
||||||||||||||||| || |||||||||| |||||| | ||||||||| ||||| |||||||| || | ||||||||| ||||||||| |
|
|
| T |
56357 |
atattatatgcaggggccggggttcgaaccccagacacttcatttctccacaattaaattgtgtgagttttagccactagactacttgacaa |
56448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 896 - 838
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
896 |
atattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaat |
838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0690 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0690
Description:
Target: scaffold0690; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 23 - 91
Target Start/End: Original strand, 3722 - 3791
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||| |||||||||| | ||||||| | ||||||||| |
|
|
| T |
3722 |
ttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacaa |
3791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 46560 - 46625
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtga |
65 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||| ||| |||||| |||||| ||||||| |
|
|
| T |
46560 |
atattatatgcaggggctggggttcgaaccccagacactccactgctccacaatttaattgtgtga |
46625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 12028 - 12115
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttg |
87 |
Q |
| |
|
|||||||||||||| || || || ||||||||||||||| ||||||||||| ||||| ||||||| || | ||||||||| ||||| |
|
|
| T |
12028 |
atattatatgcaggagccggggtttgaaccccggacactccacttctccacaattaaattgtgtgaactctagccactagactacttg |
12115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 23 - 68
Target Start/End: Complemental strand, 41667 - 41622
Alignment:
| Q |
23 |
ttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
|||||||||||||||| | |||||||||| |||||||||||||||| |
|
|
| T |
41667 |
ttcgaaccccggacaccccacttctccacgtttaaatgtgtgagct |
41622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0117 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0117
Description:
Target: scaffold0117; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 18515 - 18447
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
||||||||| ||||||| || |||||||||||||||| | ||||||||||| ||||| |||||||||| |
|
|
| T |
18515 |
atattatatacaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagct |
18447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 4 - 59
Target Start/End: Complemental strand, 27963 - 27908
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
|||||||||||||| || ||||| |||||||||||| ||||||||||| |||||| |
|
|
| T |
27963 |
ttatatgcaggggccggggttcgatccccggacactccacttctccacaattaaat |
27908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 65823 - 65732
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaa |
91 |
Q |
| |
|
|||||||||| ||||| ||| |||||| ||||||||||| |||||| ||| |||||| |||||||||| || |||||| | ||||||||| |
|
|
| T |
65823 |
atattatatgtaggggttggggttcgaatcccggacactccacttcttcacaatttaattgtgtgagctctaatcactaggctacttgacaa |
65732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1787 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold1787
Description:
Target: scaffold1787; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 434 - 492
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaat |
59 |
Q |
| |
|
||||||||||||||||| || |||||||| ||||||||| ||||||| ||| |||||| |
|
|
| T |
434 |
atattatatgcaggggccggggttcgaacctcggacactccacttctctacaattaaat |
492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 50037 - 49951
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgactt |
86 |
Q |
| |
|
|||||||||| ||||| | | ||||||| |||||||||| |||||||||| |||||| |||||||||| ||| ||||||| |||| |
|
|
| T |
50037 |
atattatatgtaggggttagggttcgaactccggacactctacttctccacaatttaattgtgtgagctctaactactagactactt |
49951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0519 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0519
Description:
Target: scaffold0519; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 68
Target Start/End: Complemental strand, 2992 - 2931
Alignment:
| Q |
7 |
tatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaatgtgtgagct |
68 |
Q |
| |
|
||||||||||| || |||||||||||||||| | ||||||| ||| |||| |||||||||| |
|
|
| T |
2992 |
tatgcaggggccggggttcgaaccccggacaccccacttctcgacaattaattgtgtgagct |
2931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 4050 - 3961
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
|||||||||||||| | || |||||||||| ||||||| |||||||||| |||||| |||||||||| | ||||||| | ||||||| |
|
|
| T |
4050 |
atattatatgcaggagtcggggttcgaaccccagacactccacttctccacaatttaattgtgtgagctctagccactaggctacttgac |
3961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0294 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0294
Description:
Target: scaffold0294; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 68
Target Start/End: Complemental strand, 17290 - 17229
Alignment:
| Q |
8 |
atgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagct |
68 |
Q |
| |
|
|||||||||| || |||||||||||||||||| |||||| |||| ||||| |||||||||| |
|
|
| T |
17290 |
atgcaggggccggggttcgaaccccggacactccacttcttcacaattaaattgtgtgagct |
17229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0288 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0288
Description:
Target: scaffold0288; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 21298 - 21347
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctcca |
50 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| |||| || ||||||||| |
|
|
| T |
21298 |
atattatatgcaggggttgggtttcgaaccccagacattccacttctcca |
21347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 23395 - 23483
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccacatttaaa-tgtgtgagcttcaaccactagacgacttgac |
89 |
Q |
| |
|
||||||||||||| ||| || ||||||||| |||||||| ||||||||| | ||||| |||||||||| ||||||||| | ||||||| |
|
|
| T |
23395 |
atattatatgcagaggccggggttcgaaccc-ggacactccacttctccataattaaattgtgtgagctctaaccactaggctacttgac |
23483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0116 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0116
Description:
Target: scaffold0116; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 79
Target Start/End: Complemental strand, 20225 - 20149
Alignment:
| Q |
4 |
ttatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactag |
79 |
Q |
| |
|
||||||||||||| || ||||||||| ||||||||| |||||| ||| |||||| |||||||| || | ||||||| |
|
|
| T |
20225 |
ttatatgcaggggtcgggtttcgaaccacggacactccacttcttcacaatttaattgtgtgagatttagccactag |
20149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0068 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0068
Description:
Target: scaffold0068; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 45944 - 46036
Alignment:
| Q |
1 |
atattatatgcaggggctggatttcgaaccccggacactcaacttctccac-atttaaatgtgtgagcttcaaccactagacgacttgacaat |
92 |
Q |
| |
|
|||||||||||||||| || ||||| |||| ||||||| |||||||||| |||||| |||||||| | | |||||| || |||||||||| |
|
|
| T |
45944 |
atattatatgcaggggtcggggttcgagccccagacactccacttctccacaatttaattgtgtgagttctagccactaaactacttgacaat |
46036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 38
Target Start/End: Original strand, 25058 - 25094
Alignment:
| Q |
2 |
tattatatgcaggggctggatttcgaaccccggacac |
38 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25058 |
tattatatgcaggggctggggttcgaaccccggacac |
25094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University