View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17061_low_55 (Length: 224)
Name: NF17061_low_55
Description: NF17061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17061_low_55 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 19 - 208
Target Start/End: Original strand, 12775338 - 12775527
Alignment:
| Q |
19 |
ttaataacttacacgaatttgactgggaagaaatgatacgatctaattgatggatctggaaactaattttaattgccggtcacgggtagagaatgtgaag |
118 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12775338 |
ttaataacttacacgaatttgattgggaagaaatgatacgatctaattgatggatctggaaactaattttaattgccggtcatgggtagagaatgtgaag |
12775437 |
T |
|
| Q |
119 |
atgaatgggataatcaaaagaggttgctggggtatatttgttaaacgtctttatgcggaaggtttgtaactgaaatcgtatgagaattat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
12775438 |
atgaatgggataatcaaaagaggttgctggggtatatttgttaaacgtctttatgcagaaggtttataactgaaatcgtatgagaattat |
12775527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 19 - 208
Target Start/End: Complemental strand, 16974967 - 16974779
Alignment:
| Q |
19 |
ttaataacttacacgaatttgactgggaagaaatgatacgatctaattgatggatctggaaactaattttaattgccggtcacgggtagagaatgtgaag |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16974967 |
ttaataacttacacgaatttgacttggaagaaatgatacgatctaattgatggacctggaaactaatttta-ttgccggtcacgggtagagaatgtgaag |
16974869 |
T |
|
| Q |
119 |
atgaatgggataatcaaaagaggttgctggggtatatttgttaaacgtctttatgcggaaggtttgtaactgaaatcgtatgagaattat |
208 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| ||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
16974868 |
atgaatgggataatcaaaagaggttgatggggtatatttgttaaatgtcttcatgcagaaggtttgtaactgaaatcgtatgagaattat |
16974779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University