View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17062_low_6 (Length: 230)
Name: NF17062_low_6
Description: NF17062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17062_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 25 - 214
Target Start/End: Complemental strand, 54380139 - 54379950
Alignment:
| Q |
25 |
gtttccctgccgaatgccctgtagcctcatccactaaacactctgatccaatcctttgcttcacagactccacatactcctcggcttgatcacaagctac |
124 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
54380139 |
gtttccctgccacatgccctgtagcctcatccactaaacactctgatccaatcctttgcttcacagactccacatactcctcggcttgatcacacgctac |
54380040 |
T |
|
| Q |
125 |
tctaaacaattcccacttttgcttaaagctttcgagagcagtgtctgttgcaatgtttttaagggcagtggaagtttctcttgcttccag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54380039 |
tctaaacaattcccacttttgcttaaagctttcgagagcagtgtctgttgcaatgtttttaagggcagtggaagtttctcttgcttccag |
54379950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 57 - 175
Target Start/End: Complemental strand, 54395275 - 54395157
Alignment:
| Q |
57 |
actaaacactctgatccaatcctttgcttcacagactccacatactcctcggcttgatcacaagctactctaaacaattcccacttttgcttaaagcttt |
156 |
Q |
| |
|
||||||| ||||||| | | ||||||||| ||||||| |||||||||||||||||||||||| |||||| ||||||||||||| ||||| |||||||||| |
|
|
| T |
54395275 |
actaaactctctgattctaccctttgctttacagactgcacatactcctcggcttgatcacatgctactttaaacaattcccatttttgtttaaagcttt |
54395176 |
T |
|
| Q |
157 |
cgagagcagtgtctgttgc |
175 |
Q |
| |
|
|||||| || |||||||| |
|
|
| T |
54395175 |
tgagagcggtatctgttgc |
54395157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University