View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17063_high_21 (Length: 504)

Name: NF17063_high_21
Description: NF17063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17063_high_21
NF17063_high_21
[»] chr4 (1 HSPs)
chr4 (1-195)||(50550382-50550576)


Alignment Details
Target: chr4 (Bit Score: 171; Significance: 1e-91; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 50550382 - 50550576
Alignment:
1 aacgctttcatcatagtaaatcaagctcatccctgggaaacgaacccaaaccatcgtcttttcaatcttagcagtggatgatacgaactccgggctccat 100  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
50550382 aacgctttcatcatagtaaatcaagctcatgcctgggaaacgaacccaaaccatcgtcttttcaatcttagcagtggatgatacgaactccaggctccat 50550481  T
101 ttagcaacagcaaggtagtgatcaaagatcatccacggaccctctccaatgactttatctctatcttcagccatgtcaaacttcatcatataaaa 195  Q
    |||||||||| |||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
50550482 ttagcaacagtaaggtaatgatcaaagatcatccacagaccctctccaatgactttatctctatcttcagccatgtcaaacttcatcgtataaaa 50550576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University