View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17063_high_21 (Length: 504)
Name: NF17063_high_21
Description: NF17063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17063_high_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 1e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 50550382 - 50550576
Alignment:
| Q |
1 |
aacgctttcatcatagtaaatcaagctcatccctgggaaacgaacccaaaccatcgtcttttcaatcttagcagtggatgatacgaactccgggctccat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
50550382 |
aacgctttcatcatagtaaatcaagctcatgcctgggaaacgaacccaaaccatcgtcttttcaatcttagcagtggatgatacgaactccaggctccat |
50550481 |
T |
|
| Q |
101 |
ttagcaacagcaaggtagtgatcaaagatcatccacggaccctctccaatgactttatctctatcttcagccatgtcaaacttcatcatataaaa |
195 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
50550482 |
ttagcaacagtaaggtaatgatcaaagatcatccacagaccctctccaatgactttatctctatcttcagccatgtcaaacttcatcgtataaaa |
50550576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University