View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17063_high_51 (Length: 366)
Name: NF17063_high_51
Description: NF17063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17063_high_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 150 - 348
Target Start/End: Complemental strand, 7067891 - 7067691
Alignment:
| Q |
150 |
ctctctgatcacaattccaacctcaaaatcttaactttcaccctctactacccttttcctgattttgcttctagggtttgttcatgttctttgaagtaca |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7067891 |
ctctctgatcacaattccaacctcaaaatcttaactttcatcctctactacccttttcctgattttgcttctagggtttgttcatgttctttgaagtaca |
7067792 |
T |
 |
| Q |
250 |
atgctgagtttcagaagcttataagattgtaattttcacctaaaattgca--nnnnnnnaagattcagttttgttgttcttgttgtgcagtttgattttc |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
7067791 |
atgctgagtttcagaagcttataagattgtaattttcacctaaaattgcatttttttttaagattcagttttgttgttcttgctgtgtagtttgattttc |
7067692 |
T |
 |
| Q |
348 |
a |
348 |
Q |
| |
|
| |
|
|
| T |
7067691 |
a |
7067691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 16 - 67
Target Start/End: Complemental strand, 7068027 - 7067976
Alignment:
| Q |
16 |
atgtctctaccttttccttctttgtgcatttcctctgcatcctagggttatg |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7068027 |
atgtctctaccttttccttctttgtgcatttcctctgcatcctagggttatg |
7067976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University