View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17063_high_52 (Length: 363)
Name: NF17063_high_52
Description: NF17063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17063_high_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 35 - 126
Target Start/End: Original strand, 189492 - 189583
Alignment:
| Q |
35 |
tatgtaattaggcccacgaacttccaattaaaataagtatatagttcttcacttcaaaaagtcgttataggtttaaagatatgtttttccac |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
189492 |
tatgtaattaggcccacgaacttccaattaaaataagtatatagttcttcacttcaaaaaatcgttataggtttaaagatatgtttttccac |
189583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 185 - 280
Target Start/End: Original strand, 189642 - 189737
Alignment:
| Q |
185 |
gtagttattgtaaaattgttctgatatttctttttcaataagtatgtgatgagaagtttttctaaacaaataaacattcaatttagtctctaaaag |
280 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
189642 |
gtagttattgtaaaattcttctaatatttctttttcaataagtatgtgatgagaagtttttctaaacaagtaaacactcaatttagtctctaaaag |
189737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 317 - 349
Target Start/End: Original strand, 47532961 - 47532993
Alignment:
| Q |
317 |
taattgatctgccggtccattaagttatttttt |
349 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
47532961 |
taattgatctgccggtcccttaagttatttttt |
47532993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University