View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17063_high_69 (Length: 301)
Name: NF17063_high_69
Description: NF17063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17063_high_69 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 22 - 284
Target Start/End: Original strand, 36006432 - 36006694
Alignment:
| Q |
22 |
gaatccgcttctgaagatgttccaagctagccacccggtgcaacggaggagctgtttgacccatcttgttcccacctacaactgctgcattgtttggctg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36006432 |
gaatccgcttctgaagatgttccaagctagccacccggtgcaacggaggagctgtttgacccatcttgttcccacctacaactgctgcattgtttggctg |
36006531 |
T |
 |
| Q |
122 |
cacattttcaattgaagaaatttctcccaacccattgctgactctcatatcatgacacggcataggattaatagatgttggttgatagaaatgatgatgt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36006532 |
cacattttcaattgaagaaatttctcccaacccattgctgactctcatatcatgacacggcataggattaatagatgttggttgatagaaatgatgatgt |
36006631 |
T |
 |
| Q |
222 |
ggatcgtcttgcacaggaacagctgcatcagctaaattgtctgaggggcttccatcaaatgct |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36006632 |
ggatcgtcttgcacaggaacagctgcatcagctaaattgtctgaggggcttccatcaaatgct |
36006694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University