View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17063_high_71 (Length: 298)
Name: NF17063_high_71
Description: NF17063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17063_high_71 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 26 - 290
Target Start/End: Original strand, 11171332 - 11171599
Alignment:
| Q |
26 |
ctttatatatattagtttctaaatgcgtatgcatcaattgattctggtggacgagataaagtcacatgag-----ctgagctactatcgatgaatgatct |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
11171332 |
ctttatatatattagtttctaaatgcgtatgcatcaaatgattctggtggacgagataaagtcacatgagctgagctgagctgctatcgatgaatgatct |
11171431 |
T |
|
| Q |
121 |
atcatgtttggaggaatccaatctttgtggaagaaaagttcatagcattgcataacttatttgtagaaattggnnnnnnnnnntgtaaaaggattctatt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
11171432 |
atcatgtttggaggaatccaatctttgtggaagaaaagttcacagcattgcataacttatttgtagaaattgg--aaaaaaaatgtaaaaggattctatt |
11171529 |
T |
|
| Q |
221 |
gaacgggatgtagtgctcaacaaacgtattttaattgaagaaattggaaacaaaatgtaataattgatga |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11171530 |
gaacgggatgtagtgctcaacaaacgtattttaattgaagaaattggaaacaaaatgtaataattgatga |
11171599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University