View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17063_high_74 (Length: 287)
Name: NF17063_high_74
Description: NF17063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17063_high_74 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 204 - 283
Target Start/End: Complemental strand, 49766881 - 49766799
Alignment:
| Q |
204 |
actactcgtcattgtccttcttcttcttc---catcaacactgtatcagctacaactgctgtaacttcatcttcttctctctc |
283 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
49766881 |
actactcgtcattgtccttcttcttcttcttccatcaacactgtatcagcaacaactgctgtaacttcatcttcttctctctc |
49766799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 48 - 105
Target Start/End: Complemental strand, 49767037 - 49766980
Alignment:
| Q |
48 |
agaaacaaccctggtgggatctgtgctttttgtcttcaagaaaaacttggtaaactcg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49767037 |
agaaacaaccctggtgggatctgtgctttttgtcttcaagaaaaacttggtaaactcg |
49766980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 57 - 103
Target Start/End: Original strand, 14137707 - 14137753
Alignment:
| Q |
57 |
cctggtgggatctgtgctttttgtcttcaagaaaaacttggtaaact |
103 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14137707 |
cctggtggtatatgtgctttttgtcttcaagaaaaacttggtaaact |
14137753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University