View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17063_high_94 (Length: 245)
Name: NF17063_high_94
Description: NF17063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17063_high_94 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 24987125 - 24986925
Alignment:
| Q |
1 |
aaaaaactcccactctttattat---agtaaatgaagatatgggtttcgttattgaccgaacaaggtttacagttgaa-----tgcatcatttgttgcac |
92 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| | |
|
|
| T |
24987125 |
aaaaaactcccaccctttattattatagtaaatgaagatatgggtttcgttattgaccgaacaaggtttacagttgaatgcaatgcatcacttgttgcgc |
24987026 |
T |
 |
| Q |
93 |
aaaactt-agagtcaagggagcataagataaggataggatagatatatacacagaatacaacagggaacattaaatgttgatttggaaaatgaaaattga |
191 |
Q |
| |
|
||||||| | |||||||||| ||||||||||||| ||| ||| ||| ||||||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
24987025 |
aaaacttaacagtcaagggatcataagataaggagagggtag--atacacacagaatacaacaggcaacattaaatgttgatttggaatatgaaaattga |
24986928 |
T |
 |
| Q |
192 |
gtc |
194 |
Q |
| |
|
||| |
|
|
| T |
24986927 |
gtc |
24986925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University