View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17063_low_102 (Length: 245)

Name: NF17063_low_102
Description: NF17063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17063_low_102
NF17063_low_102
[»] chr7 (1 HSPs)
chr7 (1-194)||(24986925-24987125)


Alignment Details
Target: chr7 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 24987125 - 24986925
Alignment:
1 aaaaaactcccactctttattat---agtaaatgaagatatgggtttcgttattgaccgaacaaggtttacagttgaa-----tgcatcatttgttgcac 92  Q
    ||||||||||||| |||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||     ||||||| ||||||| |    
24987125 aaaaaactcccaccctttattattatagtaaatgaagatatgggtttcgttattgaccgaacaaggtttacagttgaatgcaatgcatcacttgttgcgc 24987026  T
93 aaaactt-agagtcaagggagcataagataaggataggatagatatatacacagaatacaacagggaacattaaatgttgatttggaaaatgaaaattga 191  Q
    ||||||| | |||||||||| ||||||||||||| ||| |||  ||| ||||||||||||||||| |||||||||||||||||||||| |||||||||||    
24987025 aaaacttaacagtcaagggatcataagataaggagagggtag--atacacacagaatacaacaggcaacattaaatgttgatttggaatatgaaaattga 24986928  T
192 gtc 194  Q
    |||    
24986927 gtc 24986925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University