View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17063_low_109 (Length: 238)
Name: NF17063_low_109
Description: NF17063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17063_low_109 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 52609964 - 52610183
Alignment:
| Q |
1 |
tttgtttacttttgagggtaacgagtgatttgagaaaggaagagaggttacaattatggcttacttaccttatcgttgattgttttgtgagatttcttga |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52609964 |
tttgtttacgtttgagggtaacgagtgatttgagaaaggaagagaggttacaactatggcttacttaccttatcgttgattgttttgtgagatttcttga |
52610063 |
T |
 |
| Q |
101 |
gtggaggtagagtgtcaagccatgcatgaaggtaagagtttggccaagtcatcttcttacgatttgggcaagaatatgagagtgaagagagtagagtaac |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52610064 |
gtggaggtagagtgtcaagccatttgtgaaggtaagagtttggccaagtcatcttcttatgatttgggcaagaatatgagagtgaagagagtagagtaac |
52610163 |
T |
 |
| Q |
201 |
ccatttgggggaagtcaagac |
221 |
Q |
| |
|
|||||| |||||||||||||| |
|
|
| T |
52610164 |
ccattt-ggggaagtcaagac |
52610183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University