View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17063_low_113 (Length: 236)
Name: NF17063_low_113
Description: NF17063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17063_low_113 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 17 - 219
Target Start/End: Complemental strand, 39671748 - 39671546
Alignment:
| Q |
17 |
gatattggcttcatcattctgttggtgtgtgtcttgaagtagaccacaagctaacaacaaaacattaaaccattcacgtggttgatgttttcaccaagtg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39671748 |
gatattggcttcatcattctgttggtgtgtgtcttgaagtagaccacaagctaacaacaaaacattaaaccattcacgtggttgatgttttcaccaagtg |
39671649 |
T |
 |
| Q |
117 |
gatgatttcaccaatgactcaaatcatggacctagatcacctgctgtaaatgtttcacgcagttacacgcacttaatagctgatctaaaccgtagaagag |
216 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| |||||||||||||| ||| |||||||| |
|
|
| T |
39671648 |
gatgatttcaccgatgactcaaatcatggatctagatcacctgctgtaaatgcttcacgcagttacacgcatttaatagctgatctgaactttagaagag |
39671549 |
T |
 |
| Q |
217 |
tga |
219 |
Q |
| |
|
||| |
|
|
| T |
39671548 |
tga |
39671546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 142 - 179
Target Start/End: Original strand, 43681905 - 43681942
Alignment:
| Q |
142 |
atggacctagatcacctgctgtaaatgtttcacgcagt |
179 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
43681905 |
atggacctagatcgcctgctgtaaatgcttcacgcagt |
43681942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 144 - 183
Target Start/End: Original strand, 5859001 - 5859040
Alignment:
| Q |
144 |
ggacctagatcacctgctgtaaatgtttcacgcagttaca |
183 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
5859001 |
ggacctagatcccctgctctaaatgtttcacgcagttaca |
5859040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University