View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17063_low_114 (Length: 236)
Name: NF17063_low_114
Description: NF17063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17063_low_114 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 13 - 221
Target Start/End: Complemental strand, 756165 - 755957
Alignment:
| Q |
13 |
gtcatgcttgacttgggctggtaggtccctataaatcgatctggtctattctcaactatactaaaaattcaattgattattaaaataaatactaatacat |
112 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| || ||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
756165 |
gtcatgcttgacttgggccggtaggtccctataaaccggtctagtctattctcaactatactaaaaattcaattgattattaaaataaatcctaatacat |
756066 |
T |
 |
| Q |
113 |
ccataaatcacaacgtctttattgtcactattgttgaaaaagaatattgttggaattaagtctttatgtttaattattagtgaaattaccgtaaaacaat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
756065 |
ccataaatcacaacgtctttattgtcactattgttgaaaaagaatattgttggaattaagtctttatgtttaattattagtgaaattaccgtaaaacaat |
755966 |
T |
 |
| Q |
213 |
tattagtaa |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
755965 |
tattagtaa |
755957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University