View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17063_low_121 (Length: 228)
Name: NF17063_low_121
Description: NF17063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17063_low_121 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 10 - 210
Target Start/End: Complemental strand, 45156324 - 45156124
Alignment:
| Q |
10 |
agcagcacagaagagttgaaaactaaagttaagacgggttgttgttgcgtgtttagaacatgaaagtgacacagatcagattctaaaagtcacaaaaata |
109 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45156324 |
agcagcacaggagagttgaaaactaaagttaagacgggttgttgttgggtgtttagaacatgaaagtgacacagatcagattctaaaagtcacaaaaatc |
45156225 |
T |
|
| Q |
110 |
agcaaaaacaagatagaaaagaatttgatgaaaacgatataccttggtaacaaagatgagattacattcggtcttacagatgcagcaacgtcgatcatca |
209 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45156224 |
agcaaaatcaagatagaaaagaatttgatgaaaacgatataccttggtaacaaagatgagattacattcggtcttacagatgcagcaacgtcgatcatca |
45156125 |
T |
|
| Q |
210 |
c |
210 |
Q |
| |
|
| |
|
|
| T |
45156124 |
c |
45156124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University