View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17063_low_122 (Length: 224)
Name: NF17063_low_122
Description: NF17063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17063_low_122 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 15 - 209
Target Start/End: Original strand, 46735666 - 46735860
Alignment:
| Q |
15 |
taattctgctttgaaattcactctagatattatgtggttcaatgcgatggctgattatggaagtgttatattttatgattatcactcacgtgactaagaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46735666 |
taattctgctttgaaattcactctagatattatgtggttcaatgcgatggctgattatggaagtgttatattctatgattatcactcacgtgactaagaa |
46735765 |
T |
 |
| Q |
115 |
attggaactctatttcaataatttgctttaatcttggcgttaaactatgtgcaggttataaatggtaagccttacaacagaagctgtgatgtcta |
209 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46735766 |
attggaactctagttcaataatttgctttaatcttggcgttaaactatgtgcaggttatatgtggtaagccttacaacagaagctgtgatgtcta |
46735860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 15 - 201
Target Start/End: Complemental strand, 19409772 - 19409586
Alignment:
| Q |
15 |
taattctgctttgaaattcactctagatattatgtggttcaatgcgatggctgattatggaagtgttatattttatgattatcactcacgtgactaagaa |
114 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
19409772 |
taattctgctttgaaattcgctctagatattacgtggttcaatgcgatggctgattatggaagtgttatattttatgaatatcactcacatgactaagaa |
19409673 |
T |
 |
| Q |
115 |
attggaactctatttcaataatttgctttaatcttggcgttaaactatgtgcaggttataaatggtaagccttacaacagaagctgt |
201 |
Q |
| |
|
|||||||| ||||||||||||||||||| || |||||||||||| |||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
19409672 |
attggaacactatttcaataatttgcttgaaacttggcgttaaaatatgtgcaggttataaatagtaggccttacaacagaagctgt |
19409586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University