View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17063_low_123 (Length: 219)
Name: NF17063_low_123
Description: NF17063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17063_low_123 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 63; Significance: 1e-27; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 64 - 191
Target Start/End: Original strand, 1452554 - 1452671
Alignment:
| Q |
64 |
tttattgaaaagtattagattttgcctgcttatcagaattattgaatttgagttct-ttggtttttggatcaacatgtgatttaggatatgttgttaatg |
162 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |||||| ||||||||||| |
|
|
| T |
1452554 |
tttattgaaaagtatcagattttgcctgcttatcagaattattgaatttgagttctattgttttttggatc-----------taggatgtgttgttaatg |
1452642 |
T |
|
| Q |
163 |
acgatatctcacatcaggttgcctactat |
191 |
Q |
| |
|
||||||| ||||||||| ||||||||||| |
|
|
| T |
1452643 |
acgatatgtcacatcagattgcctactat |
1452671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 63 - 111
Target Start/End: Original strand, 1452046 - 1452094
Alignment:
| Q |
63 |
ttttattgaaaagtattagattttgcctgcttatcagaattattgaatt |
111 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1452046 |
ttttattgaaaagtatcagattttgcctgcttatcagaattattgaatt |
1452094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University