View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17063_low_125 (Length: 217)
Name: NF17063_low_125
Description: NF17063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17063_low_125 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 14 - 200
Target Start/End: Original strand, 31310862 - 31311045
Alignment:
| Q |
14 |
tatacttgatctgaagtggaccttagtgatgactggaatagggtccttgcgacaaagctatatgtttccggtgatttgatgaagtatctgcaggcaatcc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
31310862 |
tatacttgatctgaagtggaccttagtgatgactggaatagggtccttgcgacaaagctatatgtttccggtgatttgatgaagtatctgca-gcactcc |
31310960 |
T |
 |
| Q |
114 |
aacgttcaaattcaatggacgattgaagaacgtgtgagaggcaatataaatggaataatatatttatattttctgggacaatcgaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31310961 |
aacgttcaaattcaatggacgattgaagaac--gtgagaggcaatataaatggaataatatatttatattttctgggacaatcgaag |
31311045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University