View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17063_low_53 (Length: 369)
Name: NF17063_low_53
Description: NF17063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17063_low_53 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 9e-89; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 9e-89
Query Start/End: Original strand, 164 - 349
Target Start/End: Complemental strand, 9015095 - 9014910
Alignment:
| Q |
164 |
acaaaattatcttcatgtggcaagtgaagaaaggaaaggattaaaagcgtgaccaaaaagcatatactagtgtacatagccagaacctaccactatcaat |
263 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| | |
|
|
| T |
9015095 |
acaaaattatcttcatgtggaaagtgaagagaggaaaggattaaaagcgtgaccaaaaagcatatactagtgtacatagccagaacctaacattatcagt |
9014996 |
T |
 |
| Q |
264 |
ttagcaggagggtttttgcaaccaaagacacgacgttttgttttatctctctagccatgacaatgactcaatgagtagtactcaac |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9014995 |
ttagcaggagggtttttgcaaccaaagacacgacgttttgttttatctctctagccatgacaatgactcaatgagtagtactcaac |
9014910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 9015245 - 9015157
Alignment:
| Q |
12 |
caaaggacaggggaatgtatgaaagatgaatatgtgcttttgccattactagaagcaggggcctcaatggggaaacttattttgatgggtc |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9015245 |
caaaggacaggggaatgtatgaaagatgaat--gtgcttttgccattactagaagcaggggcctcaatggggaaacttattttgatgggtc |
9015157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University