View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17063_low_75 (Length: 301)

Name: NF17063_low_75
Description: NF17063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17063_low_75
NF17063_low_75
[»] chr1 (1 HSPs)
chr1 (22-284)||(36006432-36006694)


Alignment Details
Target: chr1 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 22 - 284
Target Start/End: Original strand, 36006432 - 36006694
Alignment:
22 gaatccgcttctgaagatgttccaagctagccacccggtgcaacggaggagctgtttgacccatcttgttcccacctacaactgctgcattgtttggctg 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36006432 gaatccgcttctgaagatgttccaagctagccacccggtgcaacggaggagctgtttgacccatcttgttcccacctacaactgctgcattgtttggctg 36006531  T
122 cacattttcaattgaagaaatttctcccaacccattgctgactctcatatcatgacacggcataggattaatagatgttggttgatagaaatgatgatgt 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36006532 cacattttcaattgaagaaatttctcccaacccattgctgactctcatatcatgacacggcataggattaatagatgttggttgatagaaatgatgatgt 36006631  T
222 ggatcgtcttgcacaggaacagctgcatcagctaaattgtctgaggggcttccatcaaatgct 284  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36006632 ggatcgtcttgcacaggaacagctgcatcagctaaattgtctgaggggcttccatcaaatgct 36006694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University