View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17063_low_88 (Length: 264)
Name: NF17063_low_88
Description: NF17063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17063_low_88 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 145
Target Start/End: Original strand, 52609713 - 52609857
Alignment:
| Q |
1 |
tatttgcgagtgcgtttgtttgtggcaaaggttgggattattgaattttatgttaatatgtaatttgtcgatttaaggagaatgaatcacatttttcaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52609713 |
tatttgcgagtgcgtttgtttgtggcaaaggttgggattattgaattttatgtcaatatgtaatttgtcgatttaaggagaatgaatcacattttccaga |
52609812 |
T |
|
| Q |
101 |
tttattgtatattgtatataagtgtggatcttgccttctaagtga |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52609813 |
tttattgtatattgtatataagtgtggatcttgccttctaagtga |
52609857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 172 - 252
Target Start/End: Original strand, 52609884 - 52609959
Alignment:
| Q |
172 |
gaacctttcaagtgtaaatgttgtatcttatagagaaattgttgttattcttgatcgaaggtacgtttttcttcttccccc |
252 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52609884 |
gaacctttcaagtgtacatgttgtatg-----gagaaattattgttattcttgattgaaggtacgtttttcttcttccccc |
52609959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University