View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17063_low_89 (Length: 260)
Name: NF17063_low_89
Description: NF17063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17063_low_89 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 53676804 - 53677047
Alignment:
| Q |
1 |
aagaatgactcgactaaacaatcttcgacttttctaatatcaatttattatacactcggctatagaaactgacttaccctaaattttgcttcatgtcgtt |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
53676804 |
aagaatgattcgactaaacaatcttcgacttttctaatatcaattgattatacactcggctatagaaattaacttaccctaaattttgcttcatgtcgtt |
53676903 |
T |
 |
| Q |
101 |
cccagcttacaatttagaatattttttagtgtaaacaaatgtccaactgattgtagcatgatgaaccgaaaatccattacatgttacttttaggactcat |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
53676904 |
cccggcttacaatttagaatattttttagtgtaaacaaatgtccaactgattgtagcacgatgagccgaaaatccattacatgttacttttagggctcat |
53677003 |
T |
 |
| Q |
201 |
aaaattggcttttactattgtattggtgaagtaaacttcaaaga |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
53677004 |
aaaattggcttttactattgtattggtgaagtaaacttgaaaga |
53677047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University