View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17063_low_92 (Length: 256)
Name: NF17063_low_92
Description: NF17063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17063_low_92 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 47 - 242
Target Start/End: Complemental strand, 28308675 - 28308476
Alignment:
| Q |
47 |
gaatcccaatgtgaacatagcatagcatggcccgaatatatatatagtagattccatttgaatggatcacgtggaaagtg-cccattcgcatgtgctact |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28308675 |
gaatcccaatgtgaacatagcatagcatggcccg----gatatataatagattccatttgaatggatcacgtggaaagtgccccattcgcatgtgctact |
28308580 |
T |
 |
| Q |
146 |
gatttgcagac------tatgagcactctggcattgttgttttcttaaatatactat-aaaaaattatatttaaatatgcatcttagaatcaaatgacaa |
238 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28308579 |
gatttgcagactatgagtatgagcactctggcattgttgttttcttaaatatactataaaaaaattatatttaaatatgcatcttagaatcaaatgacaa |
28308480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University