View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17064_low_10 (Length: 330)
Name: NF17064_low_10
Description: NF17064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17064_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 24 - 251
Target Start/End: Complemental strand, 61124 - 60887
Alignment:
| Q |
24 |
acatgtgattgaattgcaatcatgtcattttcttacattactactagtatcaacgtatcaatactaatagtgtggccaatgtccatgtatgcattcgtac |
123 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
61124 |
acatgcgattgaattgcaatcatgtcattttcttacattactactagtatcaacgtatcaatactaatagtgtggccaatgtccgtgtatgcattcgtac |
61025 |
T |
|
| Q |
124 |
ttcctagaattgcattg----------tatttagctaattagctttctagagaatgaagttggatctgacattttgcatacaatacaatacagatctgaa |
213 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
61024 |
ttcctagaattgcattgcattgcattgtatttagctaattagctttctagagaatgaagttggatctgacattttgcatacaatacaatacagatctgaa |
60925 |
T |
|
| Q |
214 |
atcgattaccaaattggtaaatagatagatcataactc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
60924 |
atcgattaccaaattggtaaatagatagatcataactc |
60887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University