View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17064_low_8 (Length: 366)
Name: NF17064_low_8
Description: NF17064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17064_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 36 - 355
Target Start/End: Complemental strand, 1913943 - 1913624
Alignment:
| Q |
36 |
catcagattgagaatgccattgcaacgagtccatatataattgatcataatgttactcttgttatgttacctcatcaacattgacatcggttgctgttat |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1913943 |
catcagattgagaatgccattgcaacgagtccatatataattgatcataatgttactcttgttatgttacctcgtcaacattgacatcggttgctgttat |
1913844 |
T |
 |
| Q |
136 |
accgggctgagccttcccgctaaagagaatttcagtagcagcatcagatttgaaacctccggtgatgctgatataaatattttgttcgtctgttttgaca |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1913843 |
accgggctgagccttcccgctaaagagaatttcagtagcagcatcagatttgaaacctccggtgatgctgatataaatattttgttcgtctgttttgaca |
1913744 |
T |
 |
| Q |
236 |
ggatatacaaagaggttcctcaaagcaggtgttagaactctcagaacaggattgtttggataccattccttgatctctcctgttcttagatcaaatgtgc |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1913743 |
ggatatacaaagaggttcctcaaagcaggtgttagaactctcagaacaggattgtttggataccattccttgatctctcctgttcttagatcaaatgtgc |
1913644 |
T |
 |
| Q |
336 |
tatcagttgttgggcaaact |
355 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
1913643 |
tatcagttgttgggcaaact |
1913624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University