View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17065_high_16 (Length: 250)
Name: NF17065_high_16
Description: NF17065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17065_high_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 73 - 238
Target Start/End: Complemental strand, 13666197 - 13666036
Alignment:
| Q |
73 |
tatgaagacacacatacgataatgcgaatattgaaagaattgcaaaaatatatatggagataattgagtcatataaattgaaataataggctcgtattta |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13666197 |
tatgaagacacacatacgataatgcgaatattgaaagaattgcaaaaatat----ggagacaattgagtcatataaattgaaataataggctcgtattta |
13666102 |
T |
|
| Q |
173 |
aaatagcctttcctattagttttgacnnnnnnnnacaatctttgaatctaactcgattgtcacctt |
238 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13666101 |
aaatagccttttctattagttttgacttttttttacaatctttgaatctaactcgattgtcacctt |
13666036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University