View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17065_high_18 (Length: 241)
Name: NF17065_high_18
Description: NF17065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17065_high_18 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 47 - 241
Target Start/End: Complemental strand, 13666535 - 13666339
Alignment:
| Q |
47 |
tctacacgtaagtagacatgcaccttaatggcaaatgaagtgtagttcgtgacatctgccgtaacaaacgcacctgcaaagtggagacttgcgtggccaa |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13666535 |
tctacacgtaagtagacatgcaccttaatggcaaatgaagtgtagttcgtgacatctaccgtaacaaacgcacctgcaaagtggagacttgcgtggccaa |
13666436 |
T |
 |
| Q |
147 |
atagtgacaataaataaagagtcataaataaataatcttatgggttgggg--tatgcattaagaatgaggatttaacaaaacacattttttacttct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
13666435 |
atagtgacaataaataaagagtcataaataaataatcttatgggttggggtatatgcatttagaatgaggatttaacaaaacacattttttacttct |
13666339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University