View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17065_high_24 (Length: 207)
Name: NF17065_high_24
Description: NF17065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17065_high_24 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 13 - 188
Target Start/End: Original strand, 4931911 - 4932088
Alignment:
| Q |
13 |
cagtatcataggatataagaccatatagctctcatgaaccataatcactcg--tccttcaatcaaagtcgtatgaatcgtctgatttccttaagagatat |
110 |
Q |
| |
|
||||||| | |||||||||||||||||| |||||||||||||||||||| | ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4931911 |
cagtatcgttggatataagaccatatagttctcatgaaccataatcacttgagtccttcaatcaaagtcgtatgaatcgtctgattcccttaagagatat |
4932010 |
T |
|
| Q |
111 |
cctaaagtgggatatccctaatggattgattacggtgaatgcttacttgaccacgcatgcgatatgagatgtccttaa |
188 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
4932011 |
cctaaagtgagatatccttaatggattgattacggtgaatgcttacttgaacccgcatgcgatatgagatgtccttaa |
4932088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University