View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17065_high_4 (Length: 467)
Name: NF17065_high_4
Description: NF17065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17065_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 200 - 449
Target Start/End: Original strand, 30804083 - 30804332
Alignment:
| Q |
200 |
ttcccgccagaataatgcgaattgcagagatatcctcaccggagttccgaacactccacggcgacagcgacgatcatcacatcctctcccaaatcgaatc |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30804083 |
ttcccgccagaataatgcgaattgcagagatatcctcaccggagctccgaacactccacggcgacagcgacgatcatcacatcctctcccaaatcgaatc |
30804182 |
T |
 |
| Q |
300 |
agtcatcaagcaaattgaatctcactccgtcaacaaacaaccaccggaaacaaccgtcgtcaatctccggcaatgtctaacgcaactgagtcaactcgct |
399 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30804183 |
aatcatcaagcaaattgaatctcactccgtcaacaaacaaccaccggaaacaaccgtcgtcaatctccggcaatgtctaacgcaactgagtcaactcgct |
30804282 |
T |
 |
| Q |
400 |
ccattttccaactcactgaagcttcagatttggaaactcagctaccgtct |
449 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30804283 |
ccattttccaactcactgaagcttcagatttggaaactcagctaccgtct |
30804332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 8 - 65
Target Start/End: Original strand, 30803823 - 30803881
Alignment:
| Q |
8 |
attatactaacggttaaatttgatatata-ttttttgggttgaaataacatagctctaa |
65 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30803823 |
attatactaacggttaaatttgatatatatttttttgggttgaaataacatagctctaa |
30803881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 84 - 123
Target Start/End: Original strand, 30803967 - 30804006
Alignment:
| Q |
84 |
gtcgacaacagctataaatttagtacaatgttgaatgggt |
123 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
30803967 |
gtcgacaacagctctaaatttagtacaatgttgaacgggt |
30804006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University