View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17065_low_18 (Length: 250)

Name: NF17065_low_18
Description: NF17065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17065_low_18
NF17065_low_18
[»] chr5 (1 HSPs)
chr5 (73-238)||(13666036-13666197)


Alignment Details
Target: chr5 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 73 - 238
Target Start/End: Complemental strand, 13666197 - 13666036
Alignment:
73 tatgaagacacacatacgataatgcgaatattgaaagaattgcaaaaatatatatggagataattgagtcatataaattgaaataataggctcgtattta 172  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    ||||| |||||||||||||||||||||||||||||||||||||||    
13666197 tatgaagacacacatacgataatgcgaatattgaaagaattgcaaaaatat----ggagacaattgagtcatataaattgaaataataggctcgtattta 13666102  T
173 aaatagcctttcctattagttttgacnnnnnnnnacaatctttgaatctaactcgattgtcacctt 238  Q
    ||||||||||| ||||||||||||||        ||||||||||||||||||||||||||||||||    
13666101 aaatagccttttctattagttttgacttttttttacaatctttgaatctaactcgattgtcacctt 13666036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University