View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17065_low_20 (Length: 242)
Name: NF17065_low_20
Description: NF17065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17065_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 6e-55; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 27436321 - 27436445
Alignment:
| Q |
1 |
cttgggattaaaaggagtagggttaccgagacatgcaaaagctgcacctattctttcgacagagaaccttcctcatgatttcgattggagagaaaaagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
27436321 |
cttgggattaaaaggagtagggttaccgagacatgcaaaagctgcacctattctttcgaccgagaaccttcctcgtgattttgattggagagaaaaagga |
27436420 |
T |
|
| Q |
101 |
gcggtcaccccggttaggaatcagg |
125 |
Q |
| |
|
||||| ||||||||||||||||||| |
|
|
| T |
27436421 |
gcggttaccccggttaggaatcagg |
27436445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 27944813 - 27944937
Alignment:
| Q |
1 |
cttgggattaaaaggagtagggttaccgagacatgcaaaagctgcacctattctttcgacagagaaccttcctcatgatttcgattggagagaaaaagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
27944813 |
cttgggattaaaaggagtagggttaccgagacatgcaaaagctgcacctattctttcgtccgagaaccttcctcgtgattttgattggagagaaaaagga |
27944912 |
T |
|
| Q |
101 |
gcggtcaccccggttaggaatcagg |
125 |
Q |
| |
|
||||| ||||||||||||||||||| |
|
|
| T |
27944913 |
gcggttaccccggttaggaatcagg |
27944937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 27549915 - 27549791
Alignment:
| Q |
1 |
cttgggattaaaaggagtagggttaccgagacatgcaaaagctgcacctattctttcgacagagaaccttcctcatgatttcgattggagagaaaaagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
27549915 |
cttgggattaaaaggagtagggttaccgagacatgcaaaagctgcacctattctttcgtccgagaaccttcctcgtgattttgattggagagaaaaagga |
27549816 |
T |
|
| Q |
101 |
gcggtcaccccggttaggaatcagg |
125 |
Q |
| |
|
||||| ||||| ||||||||||||| |
|
|
| T |
27549815 |
gcggttacccctgttaggaatcagg |
27549791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University