View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17065_low_28 (Length: 204)

Name: NF17065_low_28
Description: NF17065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17065_low_28
NF17065_low_28
[»] chr7 (1 HSPs)
chr7 (15-181)||(26881084-26881250)


Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 15 - 181
Target Start/End: Original strand, 26881084 - 26881250
Alignment:
15 cagagaggaatgtggactcaccaaaatgaagttgttcccaaggccatgatgcttagagaaatggtgaaagccggtctccttttggtggaggaggttgttt 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||    
26881084 cagagaggaatgtggactcaccaaaatgaagttgttcccaaggccatgatacttagagaaatggtgaaagccggtctccttttggtcgaggaggttgttt 26881183  T
115 taataggagtttatgttccaatcgaggaagcaaccaggcgggaattagggaacaagagaagaacaca 181  Q
    |||||||||||||||||| ||||||||||||||| |||||||||||| |||||||||||||||||||    
26881184 taataggagtttatgttctaatcgaggaagcaacgaggcgggaattacggaacaagagaagaacaca 26881250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University