View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17066_high_13 (Length: 285)
Name: NF17066_high_13
Description: NF17066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17066_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 12 - 265
Target Start/End: Complemental strand, 53679176 - 53678932
Alignment:
| Q |
12 |
ccaagaaaatatagatagcttttcaaatgaatgtctgagtgccaaagaaaatttgaattagaagtatgaacatgggaaacattggaaacatattaagcta |
111 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
53679176 |
ccaagcaaacatagatagcttttcaaatgaatgtctgagtgccaaagaaaatttgaattagaagtatgaacatgggaaacat---------actaagcta |
53679086 |
T |
|
| Q |
112 |
aatgatatgttccatggacaaagtaaccgctgcccgatctaatttccatactgctaacctataaattaatattgttaagtaaaaccctagatttccttaa |
211 |
Q |
| |
|
| |||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| | |||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
53679085 |
actgatatgttccatggacaaagtaaccactgcccgatctaatttccatactactaacgtgtaaagtaatattgttaagtaaaaccctagattcccttaa |
53678986 |
T |
|
| Q |
212 |
caactcctcctcccatgcaaacaattgacaccgtcaagttcacgtatctccacc |
265 |
Q |
| |
|
||||||||||||||||||||||||| ||| || ||| ||||||| |||||||| |
|
|
| T |
53678985 |
caactcctcctcccatgcaaacaatcgacgccaccaatttcacgtctctccacc |
53678932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University