View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17066_high_15 (Length: 272)
Name: NF17066_high_15
Description: NF17066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17066_high_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 68 - 255
Target Start/End: Original strand, 2493609 - 2493796
Alignment:
| Q |
68 |
ataatatgatgacactgccaaatttactgttcatatttcactctcaaacaaaataaaactgaacaatgaacagagaaaattaaattaaatcatatcaaac |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2493609 |
ataatatgatgacactgccaaatttactgttcaaatttcactttcaaacaaaataaaactgaacaatgaacagagaaaattaaattaaatcatatcaaac |
2493708 |
T |
|
| Q |
168 |
atttccacacgtacaagcaagccagcatcagaaaaatttcagaacagtaaccaattccaagaactaacactcctagtaccatcaactt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2493709 |
atttccacacgtacaagcaagccagcatcagaaaaatttcagaacagtaaccaattccaagaactaacactcctagtaccatcaactt |
2493796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University