View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17066_high_16 (Length: 265)
Name: NF17066_high_16
Description: NF17066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17066_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 2997206 - 2996971
Alignment:
| Q |
1 |
tcaatgcaagtgagcgacatgaatggagatatatgatatatctagaaacggggtttgatgagctctcttttttatgagaactgaatcctcttgcagtcag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2997206 |
tcaatgcaagtgagcgacatgaatggagatatatgatatatctagaaacggggtttgatgagctctcttttttatgagaac----------cgcagtca- |
2997118 |
T |
 |
| Q |
101 |
ggggatcacaaaaaacttgaaaattttagaaacttcagtaattgttttctgtacttccttactacatgaaatgtttgccatcaaatatcccaaaattgaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2997117 |
ggggatcacaaaaaacttgaaaattttagaaacatcaataattgttttctgtacttccttactacatgaaatgtttgccat-------------tttgaa |
2997031 |
T |
 |
| Q |
201 |
aaggagagctctttttgtaattgtatagtacagctttcatcgtatagtgcctatgcttct |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
2997030 |
aaggagagctctttttgtaattgtatagtacagcttgcatcgtatagtgcctatgtttct |
2996971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 67; Significance: 8e-30; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 3 - 89
Target Start/End: Original strand, 19364347 - 19364433
Alignment:
| Q |
3 |
aatgcaagtgagcgacatgaatggagatatatgatatatctagaaacggggtttgatgagctctcttttttatgagaactgaatcct |
89 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
19364347 |
aatgcacgtgagcgacatgaatggagatatatgaaatatttagaaacggggtttgatgagctctctttttgatgagaactggatcct |
19364433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University