View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17066_low_13 (Length: 306)
Name: NF17066_low_13
Description: NF17066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17066_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 13 - 283
Target Start/End: Original strand, 2493226 - 2493496
Alignment:
| Q |
13 |
atactctaattggtaatacaaattataaaaagtttacagatttggtacaccccgttatagactatggtttgtttattcatcatgtctcttctttttatca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2493226 |
atactctaattggtaatacaaattataaaaagttaacagatttgatacaccccgttatagactatggtttgtttattcatcatgtctcttctttatatca |
2493325 |
T |
 |
| Q |
113 |
aatttcatttcattcttgtatttatggagcatagtagcacagtactaaaggaattaaatagaataaaaccaccaccaatttcatcaccttccatnnnnnn |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2493326 |
aatttcatttcattcttgtatttatggagcatagtagcacagtaccaaaggaattaaatagaataaaaccaccaccaatttcatcaccttccataaaaca |
2493425 |
T |
 |
| Q |
213 |
nnnnnnnnnnnnnncttctgatcaaacagtaacactttctgcctctttctctcagacacgaatacaattta |
283 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2493426 |
aaacaaaataaaaacttctgatcaaacagcaacactttctgcctctttctctcagacacgaatacaattta |
2493496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University