View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17066_low_18 (Length: 253)
Name: NF17066_low_18
Description: NF17066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17066_low_18 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 13 - 253
Target Start/End: Original strand, 2115111 - 2115351
Alignment:
| Q |
13 |
aagaatatcggaatcaagttcttcttttgagcaaagaatctcacctcttccatgcttaaacggttgaggaaacttgaacttgtgacgatcaccaaaccaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2115111 |
aagaatatcggaatcaagttcttcttttgagcaaagaatctcacctcttccatgcttaaacggttgaggaaacttgaacttgtgacgatcaccaaaccaa |
2115210 |
T |
|
| Q |
113 |
acgcgaccgagcaaatgactctatcagcaatttcatggctttgaatatctgaatactttgatctatcagcaagtaaacaatcaatgccttgaagctcaag |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2115211 |
acgcgaccgagcaaatgactctatcagcaatttcatggctttgaatatctgaatactttgatctatcagcaagcaaacaatcaatgccttgaagctcaag |
2115310 |
T |
|
| Q |
213 |
ctcagatttaagccacttgcagaagcgaataagattcggat |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2115311 |
ctcagatttaagccacttgcagaagcgaataagactcggat |
2115351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University