View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17066_low_28 (Length: 217)
Name: NF17066_low_28
Description: NF17066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17066_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 2012328 - 2012526
Alignment:
| Q |
1 |
atgaagaaagattgtgatgagaaagaaattggttgttgtgttaaatttagttgctttggaaagtgtataccttcaagattaaaggttgatagttccaaaa |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2012328 |
atgaagaaggattgtgatgagaaagaaattggttgttgtgttaaatttagttgctttggaaagtgtataccttcaagattaaaggttgatagttccaaaa |
2012427 |
T |
 |
| Q |
101 |
gtggtaccacaagtgctcataatggtaattttgttttcttttatgcatgtttgtttagttctggaaataatctgtttgatagtaatgttacgtagaatt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2012428 |
gtggtaccacaagtgctcataatggtaattttgttttcttttatgcatgtttgtttagttctggaaataatctgtttgatagtaatgttacgtagaatt |
2012526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University