View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17066_low_6 (Length: 380)
Name: NF17066_low_6
Description: NF17066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17066_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-118; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 142 - 365
Target Start/End: Original strand, 44056988 - 44057211
Alignment:
| Q |
142 |
ctaaatttgaaagaatatggttgaagtccagttcatggacagatattgcagatggatgataaggagggaaaataatgtaagaagaaaaggaaggactatt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44056988 |
ctaaatttgaaagaatatggttgaagtccagttcttggacagatattgcagatggatgataaggagggaaaataatgtaagaagaaaaggaaggactatt |
44057087 |
T |
|
| Q |
242 |
tttcgtttttgctttgtttgacgaaaattagaaactagaggaaggtagagagaaaagaaggttggttttgttttggtggttttccactccaagtgggaat |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44057088 |
tttcgtttttgctttgtttgacgaaaattagaaactagaggaaggtagagagaaaagaaggttggttttgttttggtggttttccactccaattgggaat |
44057187 |
T |
|
| Q |
342 |
tcaagttaaattctacggcctatg |
365 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
44057188 |
tcaagttaaattctacggcctatg |
44057211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 15 - 116
Target Start/End: Original strand, 44056874 - 44056975
Alignment:
| Q |
15 |
aagagtggactctttcatgtgtcaaatttgcattaacaaggcactagcagcatataatagacaatatcacattccagcataatttgttattgagctttgt |
114 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44056874 |
aagagaggactctttcatgtgtcatatttgcattaacaaggcactagcagcatataatagacaatatcacattccagcacaatttgttattgagctttgt |
44056973 |
T |
|
| Q |
115 |
ac |
116 |
Q |
| |
|
|| |
|
|
| T |
44056974 |
ac |
44056975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University